[논문]Characteristics of HIV-Tat Protein Transduction Domain

Yoon Jong-Sub; Jung Yong-Tae; Hong Seong-Karp; Kim Sun-Hwa; Shin Min-Chul; Lee Dong-Gun; Shin Wan-Shik; Min Woo-Sung; Paik Soon-Young

Characteristics of HIV-Tat Protein Transduction Domain 원문보기

The journal of microbiology, v.42 no.4, 2004년, pp.328 - 335

Abstract ▼ AI-Helper

The human immunodeficiency virus type 1 (HIV-I) Tat protein transduction domain (PTD), which contains rich arginine and lysine residues, is responsible for the highly efficient transduction of protein through the plasma membrane. In addition, it can be secreted from infected cells and has the ability to enter neighboring cells. When the PTD of Tat is fused to proteins and exogenously added to cells, the fusion protein can cross plasma membranes. Recent reports indicate that the endogenously expressed Tat fusion protein can demonstrate biodistribution of several proteins. However, intercellular transport and protein transduction have not been observed in some studies. Therefore, this study examined the intercellular transport and protein transduction of the Tat protein. The results showed no evidence of intercellular transport (biodistribution) in a cell culture. Instead, the Tat fusion peptides were found to have a significant effect on the transduction and intercellular localization properties. This suggests that the HIV-1 PTD passes through the plasma membrane in one direction.

주제어

AI 본문요약
AI-Helper

* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.

문제 정의

Almost all of these studies added an exogenously prepared Tat fusion protein into the cells, either in culture or in vivo. With this in mind, the aim of this study was to determine the ability of the Tat fusion protein using endogenously (denatured form) and exogenously (native denatured form) prepared proteins.

제안 방법

This study confirmed the utility of HIVl Tat, as demonstrated by the transduction efficiency of the exogenously prepared Tat fusion EGFP in cell lines using fluorescence microscopy and FACS analysis (Fig. 2). It was found that Tat had a significant effect on the transduction and intercellular localization properties.
This study examined the transduction efficiencies of the exogenously expressed Tat fusion EGFP (bacteria system), and the biodistribution ability of the endogenously expressed Tat fusion EGFP (baculovirus system).

이론/모형

1A). The ABI Prism automated sequencing method was used to confirm the nucleotide sequences of all the PCR products.
The cultures were harvested with trypsin 24 h after infection and transduction, then washed and resuspended in PBS supplemented with 1% fetal bovine serum. The data collection was performed by FACS Calibur flow cytometry (Becton Dickinson, USA).

성능/효과

1-Tat. Second, the EGFP gene sequence was amplified using PCR from pEGFP-Nl (Invitrogen, USA), with the sense primer 5' AGAATCCGC-TAGCGC1ACCGGTCGCCACCCATGG 3' and antisense primer 5' GAAGATCTCTTGTACAGCTCGTCCAT 3';. The EcoRV/Bg/lI EGFP fragment of the PCR product and the EcoRV /Bglll Tat fragment of pCR 2.
It was found that Tat had a significant effect on the transduction and intercellular localization properties. Using these results, it was concluded that the exogenously added lat was sufficient for the protein transduction of EGFP across plasma membranes. A Baculovirus mediatedexpression-HIV-1 Tat-fusion, with the indicator protein, EGFR was generated in order to directly evaluate Tat, which was mediated by the intercellular protein transfer in living cells.

참고문헌 (27)

Bao, J.J., W.W. Zhang, and M.T. Kuo. 1996. Adenoviral delivery of recombinant DNA into transgenic mice bearing hepatocellular carcinomas. Hum Gene Ther. 7, 355-365
Bradford, M. A. 1976. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254
Derossi, D., A.H. Joliot, G. Chassaing, and A. Prochiantz. 1994. The third helix of the Antennapedia homeodomain translocates through biological membranes. J. Biol. Chem. 269, 10444-10450
Elliger, S., C.A. Elliger, C. Lang, and G.L. Watson. 2002. Enhanced secretion and uptake of beta-glucuronidase improves adenoassociated viral-mediated gene therapy of mucopolysaccharidosis type VII mice. Mol Ther. 5, 617-626
Elliott, G. and P. O'Hare. 1997. Intercellular trafficking and protein delivery by a herpesvirus structural protein. Cell. 88, 223-233

상세보기
Frankel, A.D. and C.O. Pabo. 1988. Cellular uptake of the tat protein from human immunodeficiency virus. Cell. 55, 1189-1193
Futaki, S., T. Suzuki, W. Ohashi, T. Yagami, S. Tanaka, K. Ueda, and Y. Sugiura. 2001. Arginine-rich peptides. An abundant source of membrane-permeable peptides having potential as carriers for intracellular protein delivery. J. Biol. Chem. 276, 5836-5840

상세보기
Gao, G.P., Y. Yang, and J.M. Wilson. 1996. Biology of adenovirus vectors with E1 and E4 deletions for liver-directed gene therapy. J. Virol. 70, 8934-8943
Green, M. and P.M. Loewenstein. 1988. Autonomous functional domains of chemically synthesized human immunodeficiency virus tat trans-activator protein. Cell 55, 1179-1188
Han, K., M.J. Jeon, K.A. Kim, J. Park, and S.Y. Choi. 2000. Efficient intracellular delivery of GFP by homeodomains of Drosophila Fushi-tarazu and engrailed proteins. Mol. Cells 10, 728-732
Ho, A., S.R. Schwarze, S.J. Mermelstein, G. Waksman, and S.F. Dowdy. 2001. Synthetic protein transduction domains: enhanced transduction potential in vitro and in vivo. Cancer. Res. 61, 474-477

상세보기
Joliot, A., C. Pernelle, H. Deagostini-Bazin, and A. Prochiantz. 1991. Antennapedia homeobox peptide regulates neural morphogenesis. Proc. Natl. Acad. Sci. USA. 88, 1864-1868
Leifert, J.A., S. Harkins, and J.L. Whitton. 2002. Full-length proteins attached to the HIV tat protein transduction domain are neither transduced between cells, nor exhibit enhanced immunogenicity. Gene Ther. 9, 1422-1428
Lieber, A., C.Y. He, L. Meuse, D. Schowalter, I. Kirillova, B. Winther, and M.A. Kay. 1997. The role of Kupffer cell activation and viral gene expression in early liver toxicity after infusion of recombinant adenovirus vectors. J. Virol. 71, 8798-8807
Moon, M.S., G.C. Lee, and C.H. Lee. 2002. Induction of Apopotosis in Human Monocytes by Human Cytomegalovirus is Related with Calcium Increase. J. Microbiol. 40, 224-229
Nagahara, H., A.M. Vocero-Akbani, E.L. Snyder, A. Ho, D.G. Latham, N.A. Lissy, M. Becker-Hapak, S.A. Ezhevsky, and S.F. Dowdy. 1998. Transduction of full-length TAT fusion proteins into mammalian cells: TAT-p27Kip1 induces cell migration. Nature Medicine 4, 1449-1452
O'Reilly, D.R., L.K. Miller, and V.A. Luckow. 1992. Baculovirus Expression Vectors: A Laboratory Manual, Oxford Univ Press, New York, USA
Park, J., J. Ryu, K.A. Kim, H.J. Lee, J.H. Bahn, K. Han, E.Y. Choi, K.S. Lee, H.Y. Kwon, and S.Y. Choi. 2002. Mutational analysis of a human immunodeficiency virus type 1 Tat protein transduction domain which is required for delivery of an exogenous protein into mammalian cells. J. Gen. Virol. 83, 1173-1181
Park, S.W., H.K. Lee, T.G. Kim, S.K. Yoon, and S.Y. Paik. 2001. Hepatocyte-specific gene expression by baculovirus pseudotyped with vesicular stomatitis virus envelope glycoprotein. Biochem. Biophys. Res. Commun. 289, 444-450
Ryu, J.Y., K.Y. Han, J.S. Park, and S.Y. Choi. 2003. Enhanced uptake of a heterologous protein with an HIV-1 Tat protein transduction domains (PTD) at both termini. Mol. Cells. 16, 385-391
Schwarze, S.R. and S.F. Dowdy. 2000. In vivo protein transduction: Intracellular delivery of biologically active proteins, compounds and DNA. Trends. Pharmacol. Sci. 21, 45-48
Schwarze, S.R., A. Ho, A. Vocero-Akbani, and S.F. Dowdy. 1999. In vivo protein transduction: delivery of a biologically active protein into the mouse. Science 285, 1569-1572
Silhol, M., M. Tyagi, M. Giacca, B. Lebleu, and E. Vives. 2002. Different mechanisms for cellular internalization of the HIV-1 Tat-derived cell penetrating peptide and recombinant proteins fused to Tat. Eur. J. Biochem. 269, 494-50
Schwarze, S. R. and S. F. Dowdy. 2000. In vivo protein transduction: intracellular delivery of biologically active protein, compounds and DNA. Trends, Pharm, Science. 21, 45-48
Vives, E., P. Brodin, and B. Lebleu. 1997. A truncated HIV-1 Tat protein basic domain rapidly translocates through the plasma membrane and accumulates in the cell nucleus. J. Biol. Chem. 272, 16010-16017

상세보기
Wender, P.A., D.J. Mitchell, K. Pattabiraman, E.T. Pelkey, L. Steinman, and J.B. Rothbard. 2000. The design, synthesis, and evaluation of molecules that enable or enhance cellular uptake: Peptoid molecular transporters. Proc. Natl. Acad. Sci. USA. 97, 13003-13008
Xia, H., Q. Mao, and B.L. Davidson. 2001. The HIV Tat protein transduction domain improves the biodistribution of beta-glucuronidase expressed from recombinant viral vectors. Nat. Biotechnol. 19, 640-644

저자의 다른 논문 :

원문 보기

ScienceON 원문보기

원문 URL 링크

한국미생물학회 : 저널
DBPia : 저널

*원문 PDF 파일 및 링크정보가 존재하지 않을 경우 KISTI DDS 시스템에서 제공하는 원문복사서비스를 사용할 수 있습니다.

내보내기 메뉴

내보내기 구분

파일저장
인쇄
메일전송

구성항목

기본정보
상세정보

관리번호, 논문명, 저널/프로시딩명, 저자 , 발행년, 권, 호, 시작페이지, 끝페이지, 발행기관

저장형식

Text(ASCII format)
Excel format
RefWorks Direct Export
RIS format (for Reference Manager, ProCite, EndNote), Scholar's Aids, Mendeley

메일정보

받는사람 (필수): @
보내는사람 (선택): @
제목
내용: KISTI 검색결과 이메일 서비스

안내

총 건의 자료가 검색되었습니다.

다운받으실 자료의 인덱스를 입력하세요. (1-10,000)

검색결과의 순서대로 최대 10,000건 까지 다운로드가 가능합니다.

데이타가 많을 경우 속도가 느려질 수 있습니다.(최대 2~3분 소요)

다운로드 파일은 UTF-8 형태로 저장됩니다.
파일의 내용이 제대로 보이지 않을실 때는 웹브라우저 상단의 보기 -> 인코딩 -> 자동선택 여부를 확인하십시오.

Text(ASCII format)
Excel format

표제어: PCR

동의어: Packet Collision Rate

용어 설명 출처 목록 (6)

용어 설명: PCR은 세균 특이성이 있는 primer를 이용하여 적은 수의 세균이 있을지라도 쉽게 검출할 수 있는 유용한 방법이며, 이를 이용하여 구강 내 치면세균막이나 타액에서 직접 세균을 검출할 수 있게 되었다[8].

AI-Helper ※ AI-Helper는 을 사용합니다.

AI-Helper

안녕하세요, AI-Helper입니다. 좌측 "선택된 텍스트"에서 텍스트를 선택하여 요약, 번역, 용어설명을 실행하세요.
※ AI-Helper는 부적절한 답변을 할 수 있습니다.

연합인증