stf 오페론은 stfA CDEFG로 구성되며, S. typhimurium과 S. choleraesuis에서는 완전하게 존재한다. 그러나 S. typhi에서는 이 오페론이 결여되어 있고 S. paratyphi A에서는 stfC의 유전자가 돌연변이 되어 있다. 이 섬모는 class 1형태의 섬모로 분류되며, StfD chaperone을 다른 섬모를 구성하는 chaperone들과 비교할 때 각 subunit들의 C-말단 잔기의 분석은 StfD chaperone이 FGS subfamily와 유사한 특성을 보였다. stf 오페론이 lacZYA 유전자와 fusion된 S. typhimurium 돌연변이 균주를 사용하여 MacConkey 고체배지에서 장시간 배양한 후 $Lac^+$ 표현형을 보이는 21 isolate들을 분리하였다. $Lac^+$ 균주들은 34 세대 당 $0.28\~1.75$의 빈도로 발생하였다. 21 isolate들은 구성적으로 stf operon을 발현했지만, 범용의 조절자인 RpoS, OmpR, CpxR등에 의해 조절되지 않았다. Mouse독성 실험에서 S. typhimurium $_X8661$은 야생형인 $_X3761$에 비교하여 6.7배의 약독화를 보였다.
stf 오페론은 stfA CDEFG로 구성되며, S. typhimurium과 S. choleraesuis에서는 완전하게 존재한다. 그러나 S. typhi에서는 이 오페론이 결여되어 있고 S. paratyphi A에서는 stfC의 유전자가 돌연변이 되어 있다. 이 섬모는 class 1형태의 섬모로 분류되며, StfD chaperone을 다른 섬모를 구성하는 chaperone들과 비교할 때 각 subunit들의 C-말단 잔기의 분석은 StfD chaperone이 FGS subfamily와 유사한 특성을 보였다. stf 오페론이 lacZYA 유전자와 fusion된 S. typhimurium 돌연변이 균주를 사용하여 MacConkey 고체배지에서 장시간 배양한 후 $Lac^+$ 표현형을 보이는 21 isolate들을 분리하였다. $Lac^+$ 균주들은 34 세대 당 $0.28\~1.75$의 빈도로 발생하였다. 21 isolate들은 구성적으로 stf operon을 발현했지만, 범용의 조절자인 RpoS, OmpR, CpxR등에 의해 조절되지 않았다. Mouse독성 실험에서 S. typhimurium $_X8661$은 야생형인 $_X3761$에 비교하여 6.7배의 약독화를 보였다.
The stf (Salmonella typhimurium fimbriae) operon consisting of stfA(CDEFG assumes to encode putative fimbriae. The complete stf operon is existed in S. typhimurium and S. choleraesuis, whereas it is absent in S. typhi. Analyses of the amino acid residues between major subunit StfA of the Stf fimbria...
The stf (Salmonella typhimurium fimbriae) operon consisting of stfA(CDEFG assumes to encode putative fimbriae. The complete stf operon is existed in S. typhimurium and S. choleraesuis, whereas it is absent in S. typhi. Analyses of the amino acid residues between major subunit StfA of the Stf fimbriae and those of known other fimbriaes suggested that Stf belongs to class I type fimbriae. Through comparison of StfD chaperone with the other fimbrial chaperones, and of C-terminus in subunits of Stf fimbriae, it belongs to FGS (with a short Fl-G1 loop) subfamily. In order to investigate the expression of stf operon, we have constructed a Salmonella strain containing a chromosomal stfA::lacZYA transcriptional fusion, resulting in S. typhimurium $_X8532$. The strain $_X8532$ lacked the expression of \beta-galactosidase$ under normal culture conditions. However, with longer incubation time of the S. typhimurium $_X8532$, we have isolated 21 individual strains exhibiting $Lac^+$ phenotype. $Lac^+$ phenotype was appeared as approximately 0.03 frequency per generation. All isolates expressed lacZ constitutively in the various environmental conditions. Various global regulatory proteins including RpoS, OmpR, and CpxR were not involved in the regulation of the stf operon. A S. typhimurium $_X8661$ mutant lacking stfAC function attenuated 6.7 folds more than that of wild type $_X3761$ in the mouse virulence test, suggesting in the somehow involved in the Salmonella pathogenesis.
The stf (Salmonella typhimurium fimbriae) operon consisting of stfA(CDEFG assumes to encode putative fimbriae. The complete stf operon is existed in S. typhimurium and S. choleraesuis, whereas it is absent in S. typhi. Analyses of the amino acid residues between major subunit StfA of the Stf fimbriae and those of known other fimbriaes suggested that Stf belongs to class I type fimbriae. Through comparison of StfD chaperone with the other fimbrial chaperones, and of C-terminus in subunits of Stf fimbriae, it belongs to FGS (with a short Fl-G1 loop) subfamily. In order to investigate the expression of stf operon, we have constructed a Salmonella strain containing a chromosomal stfA::lacZYA transcriptional fusion, resulting in S. typhimurium $_X8532$. The strain $_X8532$ lacked the expression of \beta-galactosidase$ under normal culture conditions. However, with longer incubation time of the S. typhimurium $_X8532$, we have isolated 21 individual strains exhibiting $Lac^+$ phenotype. $Lac^+$ phenotype was appeared as approximately 0.03 frequency per generation. All isolates expressed lacZ constitutively in the various environmental conditions. Various global regulatory proteins including RpoS, OmpR, and CpxR were not involved in the regulation of the stf operon. A S. typhimurium $_X8661$ mutant lacking stfAC function attenuated 6.7 folds more than that of wild type $_X3761$ in the mouse virulence test, suggesting in the somehow involved in the Salmonella pathogenesis.
* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.
문제 정의
stf 섬모 오페론은 1999년에 Morrow 등에 의해서 다양한 분자생물학적 기법을 통해 S typhimurium에서 발견되었다[17]. 본 연구에서는 StfD chaperone과 비교한 결과들을 바탕으로 Stf 섬모가 FGS subfamily에 속하며, lacZYA reporter 유전자를 이용하여 오페론이 구성적으로 발현되는 조건을 조사하였다. 또한, Stf 섬모가 병원성에 기여하는 정도를 조사한 결과를 나타내었다.
제안 방법
typhimurium LB 액체배지에서 전배양을 한 후 1/100에 해당하는 양을 새로운 LB 액체배지에 접종을 하였다. OD&ooml에서 Q8이 되었을 때 배양을 종료하고 원심분리하여 균체를 회수하였다. 회수된 균체는 BSG (buffered saline with gelatin)로 약 5xlO10 colony forming units (CFU)로 재현탁하였고 연속적으로 10배씩 희석하였다.
S, typimurium의 병원성 유발에서 sgf 오페론의 기능을 조사하기 위해 실험동물에서 독성(LDso) 실험을 실시하였다. stf 오페론에서 stfAC의 기능이 결여된 S.
지금까지 알려진 많은 섬모 오페론들의 발현은 RpoS, OmpR, CpxR 및 global regulatory 단백질들에 의해 조절되는 예가 많았다[25, 14, 22, 19]. Stf 섬모의 발현이 이와 같은 요소들에 의해 조절을 받는지를 확인하기 위해 RpoS, OmpR, 또는 CpxR 들의 결손 돌연변이를 S. typhimurium x8532로 도입하여 S. typhimurium CK34 (ΔrpoS), S. typhimurium CK35 (ΔompR) 및 S. typhimurium CK36 (ΔcpxR)을 구축하였다. Table 2에서 보여지는 것과 같이 이들 중 어떤 요소도 오페론의 발현에 영향을 미치지 못하는 것을 확인할 수 있다.
S, typimurium의 병원성 유발에서 sgf 오페론의 기능을 조사하기 위해 실험동물에서 독성(LDso) 실험을 실시하였다. stf 오페론에서 stfAC의 기능이 결여된 S. typhimurium 돌연변이 균주를 allelic exchange 방법으로 제조하여 S. typhimurium X8661 (stfAC)라고 명명하였다(Fig. 4). 야생형 S.
이 섬모는 class I 형태의 섬모로 분류되며/ StfD 사taperone을 다른 섬모를 구성하는 chaperone 들과 비교할 때 각 subunit들의 C- 말단 잔기의 분석은 StfD chaperone이 FGS subfamily와 유사한 특성을 보였다. stf 오페론이 lacZYA 유전자와 fusion된 S. typhimurium 돌연변이 균주를 사용하여 MacConkey 고체배지에서 장시간 배양한 후 Lac+ 표현형을 보이는 21 isolate들을 분리하였다. Lac+ 균주들은 34 세대 당 0.
stfA 유전자의 promoter 부분과 구조유전자의 일부를 포함하는 1.5kb EcoRI-Hzndlll DNA 단편을 S. typhimurium x 3339로부터 얻어 Klenow fragment (NEB Lab)를 처리하여 DNA 단편의 끝을 blunt로 만든 후 플라스미드 pRS415의 Smal 부위에 클로닝하여 stfA::lacZYA transcriptional fusion이 되도록 하였다(Table 1). 클로닝된 stfA DNA 단편이 올바른 방향으로 위치하였는지의 여부는 EcoRL- Aco65I과 BarnHL 제한 효소들을 사용한 DNA의 크기 비교로서 확인하였다.
본 연구에서는 StfD chaperone과 비교한 결과들을 바탕으로 Stf 섬모가 FGS subfamily에 속하며, lacZYA reporter 유전자를 이용하여 오페론이 구성적으로 발현되는 조건을 조사하였다. 또한, Stf 섬모가 병원성에 기여하는 정도를 조사한 결과를 나타내었다.
typhimurium x3339 자iromosomal DNA로부터 확보하여 stfA::lacZYA의 3’ 부분에 flanking 시켰다. 모든 클로닝된 재조합 DNA의 정확성은 위에서 설명한 바와 같이 제한 효소를 사용한 DNA 조각들의 크기 비교로서 하였다. 재조합 플라스미드인 pRS415::stfA::lacZYA에 제한효소인 NotI과 Xhol이을 처리하여 fusion 부분을 포함하는 11 kb Notl- Xhol DNA를 잘라내어 Klenow fragment를 처리하여 blunt end로 만든 후 suicide 플라스미드인 pMEG-375의 Smal site에 클로닝하여 재조합 suicide 플라스미드를 제작하였다.
typhimurium x3761과 x8661의 독성 검사를 위해 6—8주가 된 BALB/c female mouse를 사육장에서 순응을 위해 구입 후 1주일 경과된 다음에 실험을 실시하였다. 실험에 사용된 S. typhimurium LB 액체배지에서 전배양을 한 후 1/100에 해당하는 양을 새로운 LB 액체배지에 접종을 하였다. OD&ooml에서 Q8이 되었을 때 배양을 종료하고 원심분리하여 균체를 회수하였다.
오페론을 구성적으로 발현하는 S. typhimurium 돌연변이주를 구축하기 위하여 fhuB 유전자의 중간 부분에 해당하는 primer (GGTACCGCGTGA GCAGAAAA- CGTGAA)와 stfA 유전자의 중간 부분에 해당하는 stfA-R-EsRI primer (GAATTCGCCGGTATCGATAGTG)를 사용하여 S. typhimurium isolate 21의 chromosomal DNA를 template DNA로 하여 PCR로 13 kb 크기의 DNA를 증폭하였다. 증폭된 1.
클로닝된 stfA DNA 단편이 올바른 방향으로 위치하였는지의 여부는 EcoRL- Aco65I과 BarnHL 제한 효소들을 사용한 DNA의 크기 비교로서 확인하였다. 이후, stfA 유전자의 downstream에 해당하는 3.3 kb Sall DNA 조각을 S. typhimurium x3339 자iromosomal DNA로부터 확보하여 stfA::lacZYA의 3’ 부분에 flanking 시켰다. 모든 클로닝된 재조합 DNA의 정확성은 위에서 설명한 바와 같이 제한 효소를 사용한 DNA 조각들의 크기 비교로서 하였다.
모든 클로닝된 재조합 DNA의 정확성은 위에서 설명한 바와 같이 제한 효소를 사용한 DNA 조각들의 크기 비교로서 하였다. 재조합 플라스미드인 pRS415::stfA::lacZYA에 제한효소인 NotI과 Xhol이을 처리하여 fusion 부분을 포함하는 11 kb Notl- Xhol DNA를 잘라내어 Klenow fragment를 처리하여 blunt end로 만든 후 suicide 플라스미드인 pMEG-375의 Smal site에 클로닝하여 재조합 suicide 플라스미드를 제작하였다.
typhimurium isolate 21의 chromosomal DNA를 template DNA로 하여 PCR로 13 kb 크기의 DNA를 증폭하였다. 증폭된 1.3 kb DNA를 T-vector (Promega)에 클로닝한 후 다시 1.3 kb 크기의 DNA 단편을 잘라내어/ suicide vector pMEG-375에 클로닝하여 재조합 suicide 플라스미드 pBP106을 제작하 였다(Table 1). 플라스미드 pBP106을 S.
typhimurium x 3339로부터 얻어 Klenow fragment (NEB Lab)를 처리하여 DNA 단편의 끝을 blunt로 만든 후 플라스미드 pRS415의 Smal 부위에 클로닝하여 stfA::lacZYA transcriptional fusion이 되도록 하였다(Table 1). 클로닝된 stfA DNA 단편이 올바른 방향으로 위치하였는지의 여부는 EcoRL- Aco65I과 BarnHL 제한 효소들을 사용한 DNA의 크기 비교로서 확인하였다. 이후, stfA 유전자의 downstream에 해당하는 3.
희석된 일정량의 Salmo- nella를 쥐의 구강을 통해 투여하였다. 투여된 균체의 양을 계산하기 위해서 적정양의 희석액을 LB 고체배지에 도말하여 CFU을 측정하였다. 감염시킨 뒤 28일 후에 Reed와 Muench 방법으로 LDso을 계산하였다[23].
3 kb 크기의 DNA 단편을 잘라내어/ suicide vector pMEG-375에 클로닝하여 재조합 suicide 플라스미드 pBP106을 제작하 였다(Table 1). 플라스미드 pBP106을 S. typhimurium 乂8532로 도입하여 allelic exchange 방법에 의해 돌연변이주를 구축하였고 돌연변이주 내의 구획한 결손은 PCR을 이용하여 증폭된 DNA 크기의 비교로서 확인하였다. 그 외 재조합 suicide 플라스미드들인 pBP202z pBP209z pBP210을 rpoSf ompR, cpxR의 결손을 위해 사용하였다.
회수된 균체는 BSG (buffered saline with gelatin)로 약 5xlO10 colony forming units (CFU)로 재현탁하였고 연속적으로 10배씩 희석하였다. 희석된 일정량의 Salmo- nella를 쥐의 구강을 통해 투여하였다. 투여된 균체의 양을 계산하기 위해서 적정양의 희석액을 LB 고체배지에 도말하여 CFU을 측정하였다.
대상 데이터
S. typhimurium x3761과 x8661의 독성 검사를 위해 6—8주가 된 BALB/c female mouse를 사육장에서 순응을 위해 구입 후 1주일 경과된 다음에 실험을 실시하였다. 실험에 사용된 S.
知方加7侬血의 염색체 분석을 위해 사용된 programe NCBI (National Center for Biotechnology Information; http://www. ncbi.nlm.nih.gov/gquery/gquery.fcgi)^- 사용하였다. 각 단백질들을 비교하기 위한 programe MULTALIN (http:// npsa-pbiLibcp.
typhimurium 乂8532로 도입하여 allelic exchange 방법에 의해 돌연변이주를 구축하였고 돌연변이주 내의 구획한 결손은 PCR을 이용하여 증폭된 DNA 크기의 비교로서 확인하였다. 그 외 재조합 suicide 플라스미드들인 pBP202z pBP209z pBP210을 rpoSf ompR, cpxR의 결손을 위해 사용하였다.
본 연구에 사용된 균주와 플라스미드들은 Table 1에 표시되어 있다, E. coli 와 S. typhimurium는 37 ℃에서 Luria-Bertani (LB) 액체배지 또는 LB 고체배지를 사용하여 배양하였다[2]. Lactose를 함유하는 MacConkey agar (Difco)는 Salmonellae Lac+ 표현형을 검정하는데 사용되었다' 형질전환이나 플라스미드의 선택을 위해 필요한 경우에 다음의 농도로 항생제를 첨가하였다; ampicillin; 100 pg/mlz chloramphenicol; 30 pg/ml, tetracycline; 15 pg/ml.
이론/모형
투여된 균체의 양을 계산하기 위해서 적정양의 희석액을 LB 고체배지에 도말하여 CFU을 측정하였다. 감염시킨 뒤 28일 후에 Reed와 Muench 방법으로 LDso을 계산하였다[23].
일반적인 유전자조작은 Sambrook 등의 방법에 따라 실시하였다[26]. 구축된 재조합 플라스미드를 E. coli로 형질 전환 할 때에는 RbCh 법을 따랐다[10]. Salmonella로 재조합 suicide 플라스미드의 도입은 플라스미드 donor로서 E.
성능/효과
' 분리균주들을 새로운 MacConkey 고체배지로 도말하여 관찰한 결과에서 L* ac 표현형을 계속해서 유지하는 S. typhimurium isolate 21의 stf 오페론의 promoter 부분을 allelic exchange에 의해 S. typhimurium x8532로 도입했을 경우도 원래의 균주와 마찬가지로 L* ac 표현형을 유지하고 있는 것으로 미루어볼 때 S. typhimurium isolate 21의 stf promoter 부분은 stf 오페론을 구성적으로 발현시킬 수 있다고 볼 수 있다.
paratyphi A는 stf 오페론과 유사한 ste (Salmonella typhi fimbriaee) 오페론을 가지고 있었다[30]. S. paratyphi A의 SteA가 195 아미노산으로 구성되어 완전한 ste 오페론을 가지고 있는데 비교하여 S. typhi는 88 아미노산으로 구성된 짧은 SteA ORF를 이루고 있었다(Fig. 1). 이들 stf와 ste 오페 론의 유전자들 간에는 41.
사실, TEM (transmission electron microscope) 또는 StfA에 특이적인 항체를 이용한 immunogold labeled TEM으로 관찰한 결과에서 Stf 섬모를 관찰하는데 실패했다. 그러나 살아있는 S. typhimurium 세포를 이용한 dot blot의 결과로부터 세포 표면에 StfA가 존재하는 것으로 나타났다(data not shown). 이것으로 볼 때 이 Stf 섬모는 S.
typhi에서는 Morrow 등의 결과[17]와 일치하게 stf 오페론이 없었다. 그러나 특이적으 로 S. paratyphi A에서는 stf 오페론이 존재하였는데, outer membrane usher인 stfC가 419 아미노산(전체 885 아미노산 중)으로 구성된 짧은 ORF를 이루는 것으로 나타났다. 반면에, S.
평균적으로 mouse가 죽는 날짜는 투여 후 7일에서 10일 사이에 해당하였다. 따라서 S. typhimurium X3761의 LDsoe *U 인 반면에, ; typhimurium 又8661은 1.26×106 CFU으로 6.7배 정도의 약독화된 상태로 나타났다(Table 3).
2A에서 점선으로 표시된 box와 같이 StfD는 Caf 1M과 다르게 그 영역에 해당하는 잔기들이 결여되어 있는 것으로 나타났다. 또한, signal sequence가 제거된 matured form일 경우 N-말단의 Ala (A)로부터 보존적인 Arg (R)까지 7개의 아미노산 잔기를 가지는 것으로 나타났다. Fig.
4). 야생형 S. typhimu- rium x3761과 돌연변이주 x8661을 이용하여 mouse 독성 실험을 실시한 결과, S. typhimurium 乂3761의 경우에는 mouse가 6.65xl04 CFU에서 1 마리가 죽었고 6.65x10s CFU에서 모두 죽었다(Table 3). S.
오페론의 발현조건을 알아보기 위해서 재료 및 방법에서 언급한 바와 같이 stfA 유전자에 lacZYA를 fusion시킨 재조합 DNA를 야생형 S. typhimurium chromosome에 도입시켜 S. typhimurium x8532라고 명명하였다. S.
이상의 결과를 종합하면, Stf 섬모는 class I 형태의 섬모일 것으로 추정되며 FGS subfamily에 속하는 것으로 사료된다. stf 오페론은 장기간의 배양기간에 발생하는 밝혀지지 않은 어떤 인자들에 의해 stf promoter 부분의 변화에 의해 발현이 가능하며 이들의 발현에는 일반적으로 알려진 환경 적 인자들과 global regulatory 단백질들은 관여하지 않는 것으로 나타났다.
는 것을 알 수 있었다. 즉, StfA는 두 개의 보전된 Cys 잔기를 가지며, 이들 중 N-말단에 있는 Cys로부터 8잔기 상류영역에 Phe가 존재하며, C- 말단에서 2번째 잔기가 Tyr로 존재 하는데(data not shown), 이는 전형적인 class I 형태의 섬모와 일치하는 구조를 보여주었다.
당시에는 Salmonella의 유전체 염기서열이 완전히 분석되지 않았기 때문에 더 많은 정보를 알 수가 없었다. 현재 NCBI gene bank을 통한 조사 결과로부터 S. typhimurium 뿐만 아니라 다른 S. enterica sero- type들에서도 애:오페론이 존재하는 것이 확인되었다(Fig. 1).S.
후속연구
typhi는 sfeA에 돌연변이가 존재하고 보완적인 기능을 할 수 있는 유전자가 존재하지 않기 때문에 이들 섬모의 기능을 할 수 없을 것으로 판단된다. 이러한 결과들은 지금까지 유전체 염기서열이 완전히 해독된 혈청형을 중심으로 비교 분석하였기 때문에 앞으로 더 많은 혈청형에서 동일하거나 유사한 오페론이 발견될 것으로 추정된다.
참고문헌 (30)
Baumler, A. J., R. M. Tsolis, P. J. Valentine, T. A. Ficht, and F. Heffron. 1997. Synergistic effect of mutations in invA and IpfC on the ability of Salmonella typhimurium to cause murine typhoid. Infect. Immun. 65, 2254-2259
Collinson, S. K., P. C. Doig, J. L. Doran, S. Clouthier, T. J. Trust, and W. W. Kay. 1993. Thin, aggregative fimbriae mediate binding of Salmonella enteritidis to fibronectin. J. Bacteriol. 175, 12-18
Duguid, J. P., I. W. Smith, G. Dempster, and P. N. Edmunds. 1955. Non-flagellar filamentous appendages (fimbriae) and haemagglutinating activity in Bacterium coli. J. Pathol. Bacteriol. 70, 335-348
Gay, P., D. Le Coq, M. Steinmetz, T. Berkelman, and C. I. Kado. 1985. Positive selection procedure for entrapment of insertion sequence elements in gram-negative bacteria. J. Bacteriol. 164, 918-921
Grund, S., and A. Seiler. 1993. [Electron microscopic studies of fimbriae and lectin phagocytosis of Salmonella typhimurium variety copenhagen (STMVC)]. Zentralbl. Veterinarmed B. 40, 105-112
Grund,S., R. Helmuth, R. Stephan, and R. Meyer. 1988. [Fimbrial formation, antibiogram, plasmid content, lysotype and biotype of Salmonella]. Zentralbl. Veterinarmed B. 35, 138-151
Hohmann, A. W., G. Schmidt, and D. Rowley. 1978. Intestinal colonization and virulence of Salmonella in mice. Infect. Immun. 22, 763-770
Humphries, A D., M. Raffatellu, S. Winter, E. H. Weening, R. A Kingsley, R. Droleskey, S. Zhang, J. Figueiredo, S. Khare, J. Nunes, L. G. Adams, R. M. Tsolis, and A J. Baumler. 2003. The use of flow cytometry to detect expression of subunits encoded by 11 Salmonella enterica serotype Typhimurium fimbrial operons. Mol. Microbiol. 48, 1357-1376
Hung, D. L., S. D. Knight, R. M. Woods, J. S. Pinkner, and S. J. Hultgren. 1996. Molecular basis of two subfamilies of immunoglobulin-like chaperones. Embo J. 15, 3792-3805
Hung, D. L., T. L. Raivio, C. H. Jones, T. J. Silhavy, and S. J. Hultgren. 2001. Cpx signaling pathway monitors biogenesis and affects assembly and expression of P pili. Embo J. 20, 1508-1518
Lockman, H. A, and R. Curtiss, 3rd. 1992a. Isolation and characterization of conditional adherent and non-type 1 fimbriated Salmonella typhimurium mutants. Mol. Microbiol. 6, 933-945
Lockman, H. A, and R. Curtiss, 3rd. 1992b. Virulence of non-type 1-fimbriated and nonfimbriated nonflagellated Salmonella typhimurium mutants in murine typhoid fever. Infect. Immun. 60, 491-496
Morrow, B. J., J. E. Graham, and R. Curtiss, 3rd. 1999. Genomic subtractive hybridization and selective capture of transcribed sequences identify a novel Salmonella typhimurium fimbrial operon and putative transcriptional regulator that are absent from the Salmonella typhi genome. Infect. Immun. 67, 5106-5116
Neidhardt, F. C., R. Curtiss, 3rd, J. L. Ingraham et al. 1996. Escherichia coli and Salmonella; Cellular and Molecular biology, 2nd ed. ASM Press, 146-157
Nevesinjac, A Z., and T. L. Raivio. 2005. The Cpx envelope stress response affects expression of the type IV bundleforming pili of enteropathogenic Escherichia coli. J. Bacteriol. 187, 672-686
Nicholson, T. L., and A J. Baumler. 2001. Salmonella enterica serotype typhimurium elicits cross-immunity against a Salmonella enterica serotype enteritidis strain expressing LP fimbriae from the lac promoter. Infect. immun. 69, 204-212
Otto, K, and T. J. SiIhavy. 2002. Surface sensing and adhesion of Escherichia coli controlled by the Cpx-signaling pathway. Proc Natl Acad Sci USA 99, 2287-2292
Reed, L. J., and H. Muench. 1938. A simple method of estimating fifty per cent endpoints. The American Journal of Hygiene. 27, 493-497
Roland, K., R. Curtiss, 3rd, and D. Sizemore. 1999. Construction and evaluation of a delta cya delta crp Salmonella typhimurium strain expressing avian pathogenic Escherichia coli O78 LPS as a vaccine to prevent airsacculitis in chickens. Avian Dis. 43, 429-441
Romling, U., Z. Bian, M. Hammar, W. D. Sierralta, and S. Normark. 1998. Curli fibers are highly conserved between Salmonella typhimurium and Escherichia coli with respect to operon structure and regulation. J. Bacteriol. 180, 722-731
Sambrook, J., E. F. Fritsch, and T. Maniatis 1989. Molecular Cloning, A laboratory manual. 2nd edition, Cold Spring Harbor Laboratory. Cold Spring Harbor, NY
Simons, R. W., F. Houman, and N. Kleckner. 1987. Improved single and multicopy lac-based cloning vectors for protein and operon fusions. Gene. 53, 85-96
Stolpe, H., S. Grund, and W. Schroder. 1994. Purification and partial characterization of type 3 fimbriae from Salmonella typhimurium var. copenhagen. Zentralbl Bakteriol. 281, 8-15
Thanassi, D. G., E. T. Saulino, and S. J. Hultgren. 1998. The chaperone/usher pathway: a major terminal branch of the general secretory pathway. Curr Opin Microbiol. 1, 223-231
Townsend, S. M., N. E. Kramer, R. Edward, S. Baker, N. Hamlin, M. Simmonds, S. Kim, S. Maloy, J. Parkhill, G. Dougan, and A. J. Baumler. 2001. Salmonella enterica Serovar Typhi Possesses a Unique Repertoire of Fimbrial Gene Sequences. Infect. Immun. 69, 2894-2901
※ AI-Helper는 부적절한 답변을 할 수 있습니다.