E3 ligase로 알려진 Parkin은 protein quality control에서 중요한 역할을 할 뿐만 아니라, 이런 quality control system의 이상으로 나타나는 퇴행성 뇌질환에도 밀접한 연관성이었다. 이와 같이 생체의 필수적인 업무를 담당하는 Parkin의 기능을 생화학적 측면에서 연구하기 위해서는 고 순도의 단백질을 다량 정제할 수 있는 시스템이 필요하나, 아직까지 Parkin의 발현 양상과 정제법에 관한 연구가 미흡한 상태이다. 본 연구에서는 pCEX system을 이용하여 Parkin을 대장균에서 overexpression시켜 단일 스텝으로 정제할 수 있는 방법을 정립하였다. 저온의 배양조건에서 0.01 mM의 IPTC로 발현을 유도한 결과 $90\%$ 이상의 순도를 가지는 완전한 크기의 Parkin을 정제할 수 있었다. 또한, 여러 tag을 갖는 Parkin plasmid를 제작하였을 뿐만 아니라, 이들을 HEK293 세포에 transfection하여 Parkin의 발현 양상을 비교 분석하였다. 그 결과 Parkin의 N-말단에 pretense에 민감한 절단 부위가 존재한다는 사실을 확인하였다. 본 연구에서 정립한 Parkin 정제법과 포유류 세포에서 Parkin의 발현 양상에 대한 결과는 Parkin의 기질을 탐색하고,그들이 Parkin의 효소 활성 및 기능에 미치는 영향을 조사하기 위한 다양한 연구에 활용할 수 있을 것이다.
E3 ligase로 알려진 Parkin은 protein quality control에서 중요한 역할을 할 뿐만 아니라, 이런 quality control system의 이상으로 나타나는 퇴행성 뇌질환에도 밀접한 연관성이었다. 이와 같이 생체의 필수적인 업무를 담당하는 Parkin의 기능을 생화학적 측면에서 연구하기 위해서는 고 순도의 단백질을 다량 정제할 수 있는 시스템이 필요하나, 아직까지 Parkin의 발현 양상과 정제법에 관한 연구가 미흡한 상태이다. 본 연구에서는 pCEX system을 이용하여 Parkin을 대장균에서 overexpression시켜 단일 스텝으로 정제할 수 있는 방법을 정립하였다. 저온의 배양조건에서 0.01 mM의 IPTC로 발현을 유도한 결과 $90\%$ 이상의 순도를 가지는 완전한 크기의 Parkin을 정제할 수 있었다. 또한, 여러 tag을 갖는 Parkin plasmid를 제작하였을 뿐만 아니라, 이들을 HEK293 세포에 transfection하여 Parkin의 발현 양상을 비교 분석하였다. 그 결과 Parkin의 N-말단에 pretense에 민감한 절단 부위가 존재한다는 사실을 확인하였다. 본 연구에서 정립한 Parkin 정제법과 포유류 세포에서 Parkin의 발현 양상에 대한 결과는 Parkin의 기질을 탐색하고,그들이 Parkin의 효소 활성 및 기능에 미치는 영향을 조사하기 위한 다양한 연구에 활용할 수 있을 것이다.
Parkin, known as an E3 ubiquitin ligase, has essential role in protein quality control, and its severe dysfunction leads to neurodegenerative disorders. Human Parkin was excessively degraded when expressed in Escherichia coli under the conventional induction condition ($37^{\circ}C$ cultu...
Parkin, known as an E3 ubiquitin ligase, has essential role in protein quality control, and its severe dysfunction leads to neurodegenerative disorders. Human Parkin was excessively degraded when expressed in Escherichia coli under the conventional induction condition ($37^{\circ}C$ culture condition with 0.5 mM IPTG). To optimize the induction and culture conditions for recombinant human Parkin and develop a rapid method for the Parkin purification, we expressed Parkin by using PCEX system at the different culture temperatures and IPTC concentrations. The intact Parkin protein was purified to approximately $90\%$ purity with suitable amounts of protein under the optimal culture condition ($25^{\circ}C$E with 0.01 mM IPTG). Additionally, we constructed various parkin plasmids with different tagging systems and investigated their expression patterns in HEK293 cells. We found that the proteolytically sensitive site is localized within a ubiquitin-like domain of Parkin. This study developes a method for generating useful reagents to investigate biochemical properties of Parkin.
Parkin, known as an E3 ubiquitin ligase, has essential role in protein quality control, and its severe dysfunction leads to neurodegenerative disorders. Human Parkin was excessively degraded when expressed in Escherichia coli under the conventional induction condition ($37^{\circ}C$ culture condition with 0.5 mM IPTG). To optimize the induction and culture conditions for recombinant human Parkin and develop a rapid method for the Parkin purification, we expressed Parkin by using PCEX system at the different culture temperatures and IPTC concentrations. The intact Parkin protein was purified to approximately $90\%$ purity with suitable amounts of protein under the optimal culture condition ($25^{\circ}C$E with 0.01 mM IPTG). Additionally, we constructed various parkin plasmids with different tagging systems and investigated their expression patterns in HEK293 cells. We found that the proteolytically sensitive site is localized within a ubiquitin-like domain of Parkin. This study developes a method for generating useful reagents to investigate biochemical properties of Parkin.
* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.
문제 정의
또한 대장균 내에서 ParKn을 발현 시키는 경우 온도 변화에 따른 38-kDa fragment의 양적 변화는 PEST 부위가 온도에 민감하게 작용할 수 있다는 가능성을 제시한다. 대장균 내 여러 protease 중 50%가 세포질에 존재하고 있는데[24], 세포질 내에서 발현되는 Parkine 이러한 효소에 쉽게 노출 되어 일반 효소활성 온도인 37笆에서 poor PEST 부위가 공격을 받아 쉽게 분해될 수 있다.
본 연구에서는 생화학적 연구에 Parkin을 이용하기 위한 시스템 구축의 일환으로 대장균 내에서 높은 순도로 Parkin을 정제할 수 있는 적정 조건과 시스템을 확립하였다. 또한 포유류 세포인 HEK293 세포에서 Parkin의 발현양상을 분석하기 위해 여러 epitope tag을 이용한 vector 시스템을 제작하여 Parkin의 발현 특성을 확인하였다.
가설 설정
Parkin consists of functional domains: ULD; ubiquitin like domain, RING1, really interesting new gene, IBR, in-between RING, and RING2. B. Expression of GST-Parkin under general induction condition. Lane M, molecular weight standard marker; total cell lysates of E.
2A). Glutathione Sepharose 4B bead로 단백질을 정제하여 GST-Parkin 단백질의 양을 15% SDS-PAGE로 비교하였다. 그 결과 0.
상층액은 새 튜브에 옮긴 후 Protein assay solution (BioRad)을 이용해서 단백질 농도를 측정하고 15 μg의 단백질을 15% SDS-PAGE로 분리한 후 nitrocellulose membrane으로 옮겨 immunoblottin응을 실시하였다. HA (Santa Cruz), Myc (Santa Cruz), polyclonal Parkin (Cell Signaling Technology) antibody와 반응시 킨 다음 secondary antibody로 antigen-antibody complex와 반응시킨 후 ECL (Amersham Pharmacia Biotech.)로 밴드를 확인하였다.
1(+)Myc-parkin [11]을 사용하였고, Myc-HA는 Myc- Parkin-FLAG에서 XJwI과 Xhd으로 절단함으로써 Parkin- FLAG이 없어진 pcDNA-Myc vector에 pBS-Parkin- HA (Xhol과 Xbal로 절단)에서 나온 Parkin-HA fragment를 cloning 하여 제작하였다. HA-HA는 pcDNA-HA 4T4 (BamHI과 XbaI로 절단) expression vector에 Parkin-HA fragment를 cloning하여 제작하였다.
C-말단에 HA를 tagging한 Parkin-HA (C-HA로 표기), N-말단에 myc을 tagging한 Myc~Parkin (N-Myc로 표기), 양쪽 N-말단과 G말단에 HA로 tagging한 Parkin (HA-HA 표기), N-말단은 Myc, C-말단은 HA로 tag- ging한 Parkin (Myc-HA로 표기)을 제작하였다. N-Myce pcDNA3.1(+)Myc-parkin [11]을 사용하였고, Myc-HA는 Myc- Parkin-FLAG에서 XJwI과 Xhd으로 절단함으로써 Parkin- FLAG이 없어진 pcDNA-Myc vector에 pBS-Parkin- HA (Xhol과 Xbal로 절단)에서 나온 Parkin-HA fragment를 cloning 하여 제작하였다. HA-HA는 pcDNA-HA 4T4 (BamHI과 XbaI로 절단) expression vector에 Parkin-HA fragment를 cloning하여 제작하였다.
증폭한 parkin fragment를 EcoRI과 Sall 으로 절단하여 pBluescriptll KS+ (EcoRI과 Sall으로 절단)에 cloning하여 pBS-Parkin (294-465)를 얻었다. pBS-Parkin (1-301)을 EcoRI과 SticI으로 절단한 fragment와 pBS-Parkin (294465)를 SacI과 SalI으로 절단한 fragment를 동시에 pBluescriptll KS+ (EcoRI과 SMI으로 절단)에 cloning하여 pBS-Parkin (1465)를 제작하였다. pBS-Parkin (1-465)1 EcoRI과 Sall으로 절단하여 아미노산 1~465를 포함하는 parkin cDNA를 얻어 pGEX4T4 (EwRI과 SMI으로 절단)에 삽입하여 pGST-Parkin 을 제작하였다.
pBS-Parkin (1-301)을 EcoRI과 SticI으로 절단한 fragment와 pBS-Parkin (294465)를 SacI과 SalI으로 절단한 fragment를 동시에 pBluescriptll KS+ (EcoRI과 SMI으로 절단)에 cloning하여 pBS-Parkin (1465)를 제작하였다. pBS-Parkin (1-465)1 EcoRI과 Sall으로 절단하여 아미노산 1~465를 포함하는 parkin cDNA를 얻어 pGEX4T4 (EwRI과 SMI으로 절단)에 삽입하여 pGST-Parkin 을 제작하였다.
1(+)Myc-parkin [11] 을 ㎛mHI과 으로 절단하여 아미노산 1~301을 포함하는 parkin cDNA를 얻어 pBluescriptll KS+ (BamHI과 SacI으로 절단)에 cloning하여 pBS-Parkin (L301)이라고 명명하였다. pcDNA3, l(+)Myc-parkin을 template로 하여 parkin~294F primer (GCGCGAATTCGCCATGCCCAACTCCTGATI) 와 parkin- 465R primer (GCGCGTCGACCTACACGTCGAACCAGTGGTC) 를 이용하여 아미노산 294~465를 포함하는 parkin cDNA를 PCR로 증폭하였다. 증폭한 parkin fragment를 EcoRI과 Sall 으로 절단하여 pBluescriptll KS+ (EcoRI과 Sall으로 절단)에 cloning하여 pBS-Parkin (294-465)를 얻었다.
) (GenBank account number U13853) 시스템을 이용하였다. pcDNA3.1(+)Myc-parkin [11] 을 ㎛mHI과 으로 절단하여 아미노산 1~301을 포함하는 parkin cDNA를 얻어 pBluescriptll KS+ (BamHI과 SacI으로 절단)에 cloning하여 pBS-Parkin (L301)이라고 명명하였다. pcDNA3, l(+)Myc-parkin을 template로 하여 parkin~294F primer (GCGCGAATTCGCCATGCCCAACTCCTGATI) 와 parkin- 465R primer (GCGCGTCGACCTACACGTCGAACCAGTGGTC) 를 이용하여 아미노산 294~465를 포함하는 parkin cDNA를 PCR로 증폭하였다.
3). 각 plas- mid를 HEK293 세포에 transfection한 후 HA, Myc, 또는 Parkin antibody로 Parkin의 발현을 확인하였다(Fig. 4). HA antibody로 immunoblote 한 결과 N-말단 또는 C-말단을 HA로 tagging한 Parkin에서 58 kDa 크기의 밴드가 주로 확인되었다.
단백질들의 기능을 in vitro에서 생화학적인 방법으로 연구하기 위해서는 특정 단백질을 대장균에서 다량으로 발현, 정제할 수 있는 시스템이 필요하다. 대장균에서 Parkin을 다량으로 발현, 정제하기 위해 human parkin cDNA를 pGEX4T-l expression vector에 cloning하여 Escherichia coli BL21 strain 에서 GST-Parkin fusion 단백질을 발현하였다(Fig. 1). ExPASy (Expert Protein Analysis System, http://ca.
대장균에서 발현되는 human Parkine 매우 불안정하여 50% 이상 분해되는 것을 관찰할 수 있는데, 이런 분해현상이 포유류 세포에서도 나타나는지를 조사하기 위해 HEK293 세포에서 Parkin의 발현양상을 비교분석하였다. 먼저 HEK293 세포에서 발현되는 Parkin을 쉽게 확인하고자 N-말단과 C- 말단에 Myc이나 HA를 tagging한 Parkin을 발현할 수 있는 각종 expression plasmid들을 제작하였다(Fig.
이에 본 연구에서는 pGEX vector를 이용하여 대장균 내에서 Parkin을 overexpression 하고 affinity column method로 정제하여 순도 높은 Parkin 단백질을 다량 얻을 수 있는 적정 조건을 확립하였다. 또한 Parkin의 발현을 용이하게 확인할 수 있도록 HA나 Myc tagging 시스템을 이용한 vector들을 제작하여 HEK293 세포에서 Parkin의 발현양상을 비교 분석하였다.
본 연구에서는 생화학적 연구에 Parkin을 이용하기 위한 시스템 구축의 일환으로 대장균 내에서 높은 순도로 Parkin을 정제할 수 있는 적정 조건과 시스템을 확립하였다. 또한 포유류 세포인 HEK293 세포에서 Parkin의 발현양상을 분석하기 위해 여러 epitope tag을 이용한 vector 시스템을 제작하여 Parkin의 발현 특성을 확인하였다.
대장균에서 발현되는 human Parkine 매우 불안정하여 50% 이상 분해되는 것을 관찰할 수 있는데, 이런 분해현상이 포유류 세포에서도 나타나는지를 조사하기 위해 HEK293 세포에서 Parkin의 발현양상을 비교분석하였다. 먼저 HEK293 세포에서 발현되는 Parkin을 쉽게 확인하고자 N-말단과 C- 말단에 Myc이나 HA를 tagging한 Parkin을 발현할 수 있는 각종 expression plasmid들을 제작하였다(Fig. 3). 각 plas- mid를 HEK293 세포에 transfection한 후 HA, Myc, 또는 Parkin antibody로 Parkin의 발현을 확인하였다(Fig.
배양온도 37℃ 에서 90 분간 키워 충분한 양의 대장균을 확보한 뒤, 단백질의 안정성을 높이기 위해 온도를 25℃로 낮추어 여러 농도의 IPTG로 GST-fusion 단백질의 발현을 유 도하였다(Fig. 2B). 그 결과 72 kDa 크기의 GST-Parkine IPTG의 농도에 대해 큰 영향 없-1 ml 대장균 배양액 당 250 ng의 단백질을 정제할 수 있었으나, 0.
html)에서 이론적으로 계산한 Parkin의 분자량은 약 51, 651 Da이며, glutathione S-transferase (GST)의 분자량은 27, 898 Da이므로 pGEX-Parkin으로부터 약 79, 500 Da 크기의 GST-Parkin 단백질의 발현을 예상할 수 있다. 배양온도 37℃에서 0.5 mM IPTG (일반적인 배양조건)로 단백질의 발 현을 유도한 후, Gultathione Sepharose 4B bead를 이용하여 친수성의 대장균 lysate로부터 GST-Parkin 단백질을 정제하여 발현양상을 비교 분석하였다(Fig. 1). pGEX 시스템을 이용하여 37℃ 배 양온도에서 0.
상기에서 관찰되는 48-kDa fragment가 Parkin 인지 확인하기 위해 Parking 400 번째 아미노산 주변 부위를 인지하는 Parkin antibody를 이용하여 immun아)lot을 실시하였다 (Fig. 4B). 그 결과 HA antibody로 immunoblot을 했을 때와 동일하게 58 kDa과 48 kDa의 두 밴드를 확인할 수 있었다.
1% SDSZ 1% Triton X400z 1% sodium deoxycholate)로 30 분간 얼음에 놓아서 세포를 용해시킨 후 14, 400 xg에서 30 분간 원심분리하여 세포 찌꺼 기를 제거하였다. 상층액은 새 튜브에 옮긴 후 Protein assay solution (BioRad)을 이용해서 단백질 농도를 측정하고 15 μg의 단백질을 15% SDS-PAGE로 분리한 후 nitrocellulose membrane으로 옮겨 immunoblottin응을 실시하였다. HA (Santa Cruz), Myc (Santa Cruz), polyclonal Parkin (Cell Signaling Technology) antibody와 반응시 킨 다음 secondary antibody로 antigen-antibody complex와 반응시킨 후 ECL (Amersham Pharmacia Biotech.
포유류 세포에서 발현되는 plasmid는 LipofectAMINE reagent (Invitrogen)> 사용하여 HEK293 세포에 transfection 하였다. 세포에 DNA를 tTansfection하여 24시간 경과한 후 세포를 harvest하여 배지를 제거하고 RIPA buffer (20 mM Tris, pH 75, 150 mM NaCl, 0.1% SDSZ 1% Triton X400z 1% sodium deoxycholate)로 30 분간 얼음에 놓아서 세포를 용해시킨 후 14, 400 xg에서 30 분간 원심분리하여 세포 찌꺼 기를 제거하였다. 상층액은 새 튜브에 옮긴 후 Protein assay solution (BioRad)을 이용해서 단백질 농도를 측정하고 15 μg의 단백질을 15% SDS-PAGE로 분리한 후 nitrocellulose membrane으로 옮겨 immunoblottin응을 실시하였다.
05% SDS)로 4번 씻어주고 SDS-lysis buf如를 첨가해 준 후 3 분간 끓인다. 이를 15% SDS-polyacrylamide gel 에 걸어서 전기영동을 하고 Coomassie staining solution (0.1% Brilliant blue R, Sigma, 45% methanol, 10% acetic acid)으로 20 분간 염색시킨 후 destaining solution (10% methanol, 10% acetic acid)으로 씻어내어 단백질 밴드를 확 인하였다.
PEST 부위 (proline (P), glutamate (E), serine (S), threonine (T))를 많이 가진 단백질들은 proteolysis signal을 전달 하는데[23], Parkin의 경우도 이런 부위로 인해 절단될 가능성이 높다. 이를 알아보기 위해 PEST find program (https: //embl.bcc.univie.ac.at/ toolbox/pestfind/pestfind- analy- sis-webtool.htm)을 이용하여 Parkin 아미노산 서열을 분석하였다. 그 결과 Parkin 단백질 내에 7군데의 poor PEST sequence?} 존재하는데, Parkin의 N-말단(76~89 아미노산 잔기)에 위치하는 PEST sequence?} protease에 의해 공격을 받으면 약 10 kDa 크기의 fragment가 생성될 가능성이 있다.
대장균 시스템에서 분해되지 않고 순도 높은 Parkin 단백질을 얻기 위해 단백질의 발현 유도를 위한 적정조건을 정립할 필요가 있다. 이를 위해 여러 배양 온도와 IPTG 농도에서 GST-Parkin 단백질을 발현하여 정제 하였다(Fig. 2). 일반적으로 사용되는 조건인 37℃에서 90 분 간 배양하고 37℃에서 90 분간 여러 농도의 IPTG (0.
대장균 내에서 일반적인 조건으로 발현시킨 경우 Parkin 단백질이 분해되어 순도 높은 Parkin 단백질을 얻을 수 없는 문제점이 발생하였다. 이를 해결하기 위해 여러 배양 및 유도 온도와 IPTG 농도에서 Parkin을 발현, 정제한 후 Parkin 의 발현 양상을 비교 분석하였다. 그 결과 25℃의 배양 및 유 도 온도와 0.
또한, 포유류 세포에서 Parkin 의 발현양상과 기능을 연구하기 위해서 Parkin을 발현할 수 있는 시스템을 구축할 필요가 있다. 이에 본 연구에서는 pGEX vector를 이용하여 대장균 내에서 Parkin을 overexpression 하고 affinity column method로 정제하여 순도 높은 Parkin 단백질을 다량 얻을 수 있는 적정 조건을 확립하였다. 또한 Parkin의 발현을 용이하게 확인할 수 있도록 HA나 Myc tagging 시스템을 이용한 vector들을 제작하여 HEK293 세포에서 Parkin의 발현양상을 비교 분석하였다.
pcDNA3, l(+)Myc-parkin을 template로 하여 parkin~294F primer (GCGCGAATTCGCCATGCCCAACTCCTGATI) 와 parkin- 465R primer (GCGCGTCGACCTACACGTCGAACCAGTGGTC) 를 이용하여 아미노산 294~465를 포함하는 parkin cDNA를 PCR로 증폭하였다. 증폭한 parkin fragment를 EcoRI과 Sall 으로 절단하여 pBluescriptll KS+ (EcoRI과 Sall으로 절단)에 cloning하여 pBS-Parkin (294-465)를 얻었다. pBS-Parkin (1-301)을 EcoRI과 SticI으로 절단한 fragment와 pBS-Parkin (294465)를 SacI과 SalI으로 절단한 fragment를 동시에 pBluescriptll KS+ (EcoRI과 SMI으로 절단)에 cloning하여 pBS-Parkin (1465)를 제작하였다.
대장균을 37℃ 또는 25℃ 에서 16 시간 배양한 후, ampicillin을 포함하는 LB 배지에 10%로 접종한 후 90 분 더 배양하였다. 최종 농도가 0.01, 0.1, 0.5 mM 되게 isopropyl-1-thio-β-galatopyranoside (IPTG)를 첨가하여 GST-Parkin 단백질의 발현을 유도하였다. 수확한 대장균 세포들은 EBC lysis buffer (0.
포유류 세포에서 Parkin을 발현시키기 위해 CMV promoter 가 존재하는 expression vector인 pcDNA 3.0 (InvitTOgen)을 변형하여 이용하였다. C-말단에 HA를 tagging한 Parkin-HA (C-HA로 표기), N-말단에 myc을 tagging한 Myc~Parkin (N-Myc로 표기), 양쪽 N-말단과 G말단에 HA로 tagging한 Parkin (HA-HA 표기), N-말단은 Myc, C-말단은 HA로 tag- ging한 Parkin (Myc-HA로 표기)을 제작하였다.
대상 데이터
대장균에서 GST에 fuse된 Parkin을 발현하기 위해 pGEX4T-l (Amersham Pharmacia Biotech.) (GenBank account number U13853) 시스템을 이용하였다. pcDNA3.
성능/효과
1). ExPASy (Expert Protein Analysis System, http://ca.expasy.org/tools/ pi_tool.html)에서 이론적으로 계산한 Parkin의 분자량은 약 51, 651 Da이며, glutathione S-transferase (GST)의 분자량은 27, 898 Da이므로 pGEX-Parkin으로부터 약 79, 500 Da 크기의 GST-Parkin 단백질의 발현을 예상할 수 있다. 배양온도 37℃에서 0.
4). HA antibody로 immunoblote 한 결과 N-말단 또는 C-말단을 HA로 tagging한 Parkin에서 58 kDa 크기의 밴드가 주로 확인되었다. 대장균에서처럼 여러 fragment들이 관찰되지는 않았지만, 58 kDa 밴드 외에 48 kDa 위치에서 또 다른 frag- ment를 확인할 수 있었다(Fig.
N-말단이나 C-말단 tag을 인지하는 antibody로 HEK293 세포에서 발현되는 Parkin을 immunoblot 한 후, 단백질의 크기를 비교 분석한 결과 48-kDa fragment는 N-말단이 절단된 Parkin 단백질임을 알 수 있었다. 이는 Parkin의 N-말단 으로부터 10 kDa 떨어진 ULD에 존재하는 아미노산 부위에서 절단된 fragment임을 알 수 있다.
Glutathione Sepharose 4B bead로 단백질을 정제하여 GST-Parkin 단백질의 양을 15% SDS-PAGE로 비교하였다. 그 결과 0.01 mM의 IPTG 농도에서는 1 ml 대장균 배양액 당 250 ng의 GST-Parkin (79 kDa)을 확인할 수 있었으나, 0.1 mM과 0.5 mM의 IPTG 농도에서는 5배 더 적은 50 ng을 관찰할 수 있었다. 또한, 이 조건에서 72kDa 외에도 29, 30, 38, 40, 43, 45 kDa 크기의 6개 밴드가 더 나타났다.
이를 해결하기 위해 여러 배양 및 유도 온도와 IPTG 농도에서 Parkin을 발현, 정제한 후 Parkin 의 발현 양상을 비교 분석하였다. 그 결과 25℃의 배양 및 유 도 온도와 0.01 mM의 IPTG 조건에서 Parkin의 분해가 가장 적게 일어나고 단백질의 회수율이 0.2% (1 ml 대장균 배양액 당 50 ng/25 pg, 정제된 GST-Parkin/전체 세포 추출물) 정도로 대장균 1 리터로부터 순도 90% 이상의 GST-Parkin 단백질을 50 pg 정도 정제할 수 있었다. 비록 양은 적지만 순도 높은 Parkin을 정제하는 방법을 확립 하였으므로, 이 방법을 이용하여 생화학적 연구에 적용할 수 있는 Parkin 단백질을 다량 정제할 수 있다.
2B). 그 결과 72 kDa 크기의 GST-Parkine IPTG의 농도에 대해 큰 영향 없-1 ml 대장균 배양액 당 250 ng의 단백질을 정제할 수 있었으나, 0.1 mM과 0.5 mM 농도의 IPTG에서 38 kDa과 40 kDa의 단백질 fragment들은 0.01 mM 농도에서 보다 10배 더 많은 2.5 ㎍의 단백질 양을 확인할 수 있었다. 상기의 조건에서 단백질 분해가 증가되므로 배양조건도 25℃로 낮추어 발현한 결과 0.
4B). 그 결과 HA antibody로 immunoblot을 했을 때와 동일하게 58 kDa과 48 kDa의 두 밴드를 확인할 수 있었다. 이들 immunoblot 결과를 바탕으로 48-kDa fragment는 Parkin 의 N-말단 Myc-tag부분이 절단되고 C-말단의 HA-tag를 포함하는 Parkin임을 알 수 있었다(Fig.
5 ㎍의 단백질 양을 확인할 수 있었다. 상기의 조건에서 단백질 분해가 증가되므로 배양조건도 25℃로 낮추어 발현한 결과 0.01 mM IPTG 유도 조건에서는 분해된 fragment 없이 순수한 79 kDa 의 GST-Parkin만을 1 ml 대장균 배양액 당 50 ng을 얻을 수 있 었다(Fig. 2C, lane 1). 따라서 고온의 배양온도와 고농도의 IPTG가 Parkin 단백질의 안정성에 크게 영향을 미치는 것을 알 수 있다.
그 결과 HA antibody로 immunoblot을 했을 때와 동일하게 58 kDa과 48 kDa의 두 밴드를 확인할 수 있었다. 이들 immunoblot 결과를 바탕으로 48-kDa fragment는 Parkin 의 N-말단 Myc-tag부분이 절단되고 C-말단의 HA-tag를 포함하는 Parkin임을 알 수 있었다(Fig. 4A, lane 2). 따라서 Parkin의 N-말단으로부터 약 10 kDa정도 위치에 세포 내 protease에 민감한 절단 부위가 존재하는 것을 알 수 있다.
또한, 이 조건에서 72kDa 외에도 29, 30, 38, 40, 43, 45 kDa 크기의 6개 밴드가 더 나타났다. 특히, 38-kDa fragment는 1 ml 대장균 배양액 당 500 ng으로 72 kDa 크기의 GST-Parkin보다 10배 더 많은 양을 gel 상에서 확인할 수 있었다.
후속연구
그러나 Parkin과 상호작용하는 단백질이나 Parkin 의 기질에 대한 생화학적, 생리학적 측면에서의 기능 연구는 아직까지 상당 부분 수행되지 않은 상태이다. Parkin과 상호작용하는 단백질들과 기질에 대한 연구가 생화학적, 분자생물학적 측면에서 이루어진다면 퇴행성 뇌질환의 발병기전을 분자 수준에서 밝혀나갈 수 있을 것이다.
대장균 내 여러 protease 중 50%가 세포질에 존재하고 있는데[24], 세포질 내에서 발현되는 Parkine 이러한 효소에 쉽게 노출 되어 일반 효소활성 온도인 37笆에서 poor PEST 부위가 공격을 받아 쉽게 분해될 수 있다. 이를 증명하기 위해 분해 가능성 있는 부위의 아미노산의 돌연변이를 통해 Parkin의 절단부위와 protease와의 상관관계를 규명하는 연구가 필요하다. 최근 Parkin의 1에서 6의 아미노산 잔기가 Parkin 유전자의 발현에 중요한 역할을 하고, ULD가 없는 경우 E3 ligase 기능에는 영향을 미치지는 않지만 ULD가 있는 경우보다 발현 양이 증가한다는 보고가 있다[26].
참고문헌 (26)
Ardley H. C., C. C. Hung, and P. A. Robinson. 2005. The aggravating role of the ubiquitin-proteasome system in neurodegeneration. FEBS Lett. 579, 571-576
Cyr D. M., J. Hohfeld, and C.Patterson. 2002. Protein quality control: Ll-box-containing E3 ubiquitin ligases join the fold. Trends Biochem Sci. 27, 368-375
McClellan A. J., S. Tam, D. Kaganovich and J. Frydman. 2005. Protein quality control: chaperones culling corrupt conformations. Nat Cell BioI. 71 736-741
Korhonen L.and D. Lindholm. 2004. The ubiquitin proteasome system in synaptic and axonal degeneration: a new twist to an old cycle. J Cell Biol. 165, 27-30
Tsai Y. C. P. S. Fishman, N. V. Thakor and G. A. Oyler 2003. Parkin facilitates the elimination of expanded polyglutamine proteins and leads to preservation of proteasome function. J Bioi Chem. 278, 22044-22055
Shimura H., N. Hattori, S. Kubo, Y. Mizuno,S. Asakawa, S. Minoshima, N. Shimizu, K. Iwai, T. Chiba, K. Tanaka and T. Suzuki. 2000. Familial Parkinson disease gene product, parkin, is a ubiquitin-protein ligase. Nat Genet. 25, 302-305
Lim K. L., K. C. Chew, J. M. Tan, C. Wang, K. K. Chung, Y. Zhang, Y. Tanaka, W. Smith, S. Engelender, C. A.Ross, V. L. Dawson and T. M. Dawson. 2005. Parkin mediates nonclassical, proteasomal-independent ubiquitination of synphilin-l: implications for Lewy body formation. J Neurosci. 25, 2002-2009
Choi P., H. Snyder, L. Petrucelli, C. Theisler, M. Chong, Y. Zhang, K. Lim, K. K. Chung, K. Kehoe, L. D' Adamio, J. M. Lee, E. Cochran, R. Bowser, T. M. Dawson and B. Wolozin. 2003. SEPT5_v2 is a parkin-binding protein. Brain Res Mol Brain Res. 117, 179-189
Corti O., C. Hampe, H. Koutnikova, F. Darios, S. Jacquier, A. Prigent, J. C. Robinson, L. Pradier, M. Ruberg, M. Mirande, E. Hirsch, T. Rooney, A. Fournier and A. Brice. 2003. The p38 subunit of the aminoacyl-tRNA synthetase complex is a Parkin substrate: linking protein biosynthesis and neurodegeneration. Hum Mol Genet. 12, 1427-1437
Huynh D. P., D. R. Scoles, D. Nguyen, S. M. Pulst. 2003. ?The autosomal recessive juvenile Parkinson disease gene product, parkin, interacts with and ubiquitinates synaptotagmin XI. Hum Mol Genet. 12, 2587-2597
Ren Y., J. Zhao, J. Feng. 2003. Parkin binds to alpha/beta tubulin and increases their ubiquitination and degradation. J Neurosci.23, 3316-3324
Zhang Y., J. Gao, K. K. Chung, H. Huang, V. L. Dawson, T. M. Dawson. 2000. Parkin functions as an E2-dependent ubiquitin- protein ligase and promotes the degradation of the synaptic vesicle-associated protein, CDCrel-1. Proc Natl Acad Sci USA. 97, 13354-13359
Seong Y. M., H. J. Park, G. H Seong, J. Y. Choi, S. J. Yoon, B. R. Min, S. Kang and H. Rhim. 2004. N-terminal truncation circumvents proteolytic degradation of the human HtrA2/0mi serine protease in Escherichia coli: rapid purification of a proteolyticaTIy active HtrA2/Omi. Protein Expr Purif. 33, 200-208
Huynh D. P., M. Dy, D. Nguyen, T. R. Kiehl, S. M. Pulst. 2001. Differential expression and tissue distribution of parkin isoforms during mouse development. Brain Res Dev Brain Res. 130, 173-181
Rechsteiner M. and S. W. Rogers. 1996. PEST sequences and regulation by proteolysis. Trends Biochem Sci. 21, 267271
Murby M., M. Uhlen M and S. Stahl. 1996. Upstream strategies to minimize proteolytic degradation upon recombinant production in Escherichia coli. Protein Expr Purif. 7, 129-136
Kim H. S., J. S. Yoo, Y. G. Kim, C. H. Chung and Y. L. Choi. 1999. Cloning and Expression of Serratia marcescens Coenzyme A (CoA) Transferase Gene in E. coli. J. Life Science. 9, 54-57
Finney N., F. Walther, P. Y. Mantel, D. Stauffer, G. Rovelli and K. K. Dev. 2003. The cellular protein level of parkin is regulated by its ubiquitin-like domain. J Bioi Chem. 278, 16054-1608
※ AI-Helper는 부적절한 답변을 할 수 있습니다.