Kita, K.
(Laboratory of Animal Feeds and Production, University Farm, Graduate School of Bioagricultural Sciences Nagoya University)
,
Harada, K.
(Laboratory of Animal Feeds and Production, University Farm, Graduate School of Bioagricultural Sciences Nagoya University)
,
Nagao, K.
(Laboratory of Animal Feeds and Production, University Farm, Graduate School of Bioagricultural Sciences Nagoya University)
,
Yokota, H.
(Laboratory of Animal Feeds and Production, University Farm, Graduate School of Bioagricultural Sciences Nagoya University)
Ghrelin is a novel growth-hormone-releasing acylated peptide, which has been purified and identified in rat stomach. In the present study, the full-length sequence of bovine ghrelin cDNA was cloned by RT-PCR. The bovine ghrelin cDNA sequence derived in the present study included a 348 bp open readin...
Ghrelin is a novel growth-hormone-releasing acylated peptide, which has been purified and identified in rat stomach. In the present study, the full-length sequence of bovine ghrelin cDNA was cloned by RT-PCR. The bovine ghrelin cDNA sequence derived in the present study included a 348 bp open reading frame and a 137 bp 3'UTR. The putative amino acid sequence of bovine prepro-ghrelin consisted of 116 amino acids, which contained the 27-amino acid ghrelin. The sequence analysis of the bovine ghrelin gene revealed that an intron existed between Gln$^{13}$ and Arg$^{14}$ of ghrelin. This exon-intron boundary matched the GT-AG rule of the splicing mechanism. Compared with rats, which have two tandem CAG sequences in the 3'end of intron, bovine ghrelin genome has only one CAG sequence. Therefore, although rats can produce 28 amino acid-ghrelin and 27 amino acid-des-Gln$^{14}$-ghrelin by alternative splicing, ruminant species, including bovines, might be able to produce only one type of ghrelin peptide, des-Gln$^{14}$-ghrelin. The influence of aging on plasma ghrelin concentration was also examined. Plasma ghrelin concentration increased after birth to approximately 600 days of age, and then remained constant.
Ghrelin is a novel growth-hormone-releasing acylated peptide, which has been purified and identified in rat stomach. In the present study, the full-length sequence of bovine ghrelin cDNA was cloned by RT-PCR. The bovine ghrelin cDNA sequence derived in the present study included a 348 bp open reading frame and a 137 bp 3'UTR. The putative amino acid sequence of bovine prepro-ghrelin consisted of 116 amino acids, which contained the 27-amino acid ghrelin. The sequence analysis of the bovine ghrelin gene revealed that an intron existed between Gln$^{13}$ and Arg$^{14}$ of ghrelin. This exon-intron boundary matched the GT-AG rule of the splicing mechanism. Compared with rats, which have two tandem CAG sequences in the 3'end of intron, bovine ghrelin genome has only one CAG sequence. Therefore, although rats can produce 28 amino acid-ghrelin and 27 amino acid-des-Gln$^{14}$-ghrelin by alternative splicing, ruminant species, including bovines, might be able to produce only one type of ghrelin peptide, des-Gln$^{14}$-ghrelin. The influence of aging on plasma ghrelin concentration was also examined. Plasma ghrelin concentration increased after birth to approximately 600 days of age, and then remained constant.
* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.
제안 방법
Female cattle were 192 to 4,093 days old and male cattle were 176 to 842 days old. All cattle were fed on Italian ryegrass silage prepared in the farm, and diets were given at 9:00 and 16:00. Cattle were allowed free access to drinking water and tracemineralized salt blocks (Cow candy, Mercian Co.
To confirm the full sequence of complete bovine ghrelin cDNA, RT-PCR was conducted using sense and antisense primers based on the sequence derived in the present study as follows: forward 5'- ATGCCCGCCCCGTGGACCAT -3', reverse 5'- GCATCCATCTGAGCATTTAT -3'. Sequencing reactions were carried out on the above primers, using an ABI 310 PRISM automated DNA sequencer and the accompanying software (Perkin Elmer Japan, Yokohama, Japan).
대상 데이터
Japanese Black cattle (21 female and 4 male) and F1 back-cross cattle (F1 (HolsteinxJapanese Black)xJapanese Black) (10 female and 10 male), bred in University Farm of Nagoya University, Japan, were used. Female cattle were 192 to 4,093 days old and male cattle were 176 to 842 days old.
Japanese Black cattle (21 female and 4 male) and F1 back-cross cattle (F1 (HolsteinxJapanese Black)xJapanese Black) (10 female and 10 male), bred in University Farm of Nagoya University, Japan, were used. Female cattle were 192 to 4,093 days old and male cattle were 176 to 842 days old.
성능/효과
In this report, genome sequence of rat ghrelin was also analyzed, and it was revealed that an intron existed between Gln13 and Gln14 and the 3’-end of the intron had two tandem CAG sequences.
, 2000). In this report, genome sequence of rat ghrelin was also analyzed, and it was revealed that an intron existed between Gln13 and Gln14 and the 3’-end of the intron had two tandem CAG sequences. Two tandem CAG sequences of the exon-intron boundary matched the GT-AG rule of splicing mechanism (McKeown 1992), resulting in two types of ghrelin peptides coding 27 and 28 amino acids produced by alternative splicing.
참고문헌 (13)
Kojima, M., H. Hosoda and K. Kangawa. 2001. Purification and distribution of ghrelin: The natural endogenous ligand for the growth hormone secretagogue receptor. Horm. Res. 56 (Suppl. 1):93-97.
Kojima, M., H. Hosoda, Y. Date, M. Nakazato, H. Matsuo and K. Kangawa. 1999. Ghrelin is a growth-hormone releasing acylated peptide from stomach. Nature 402:656-660.
Hashizume, T., M. Horiuchi, N. Tate, S. Kojima, H. Hosoda and K. Kangawa. 2003. Effects of ghrelin on growth hormone secretion from cultured adenohypophysical cells in cattle. Endocrine J. 50:289-295.
Hosoda, H., M. Kojima, H. Matsuo and K. Kangawa. 2000. Purification and characterization of rat des-Gln14-ghrelin, a second endogenous ligand for the growth hormone secretagogue receptor. J. Biol. Chem. 275:21995-22000
McKeown, M. 1992. Alternative mRNA splicing. Ann. Rev. Cell. Biol. 8:133-55.
Nakazato, M., N. Murakam, Y. Date, M. Kojima, H. Matsuo, K. Kangawa and S. Matsukura. 2001. A role for ghrelin in the central regulation of feeding. Nature 409:194-198.
Rigamonti, A. E., A. I. Pincelli, B. Corra, R. Viarengo, S. M. Bonomo, D. Galimberti, M. Scacchi, E. Scarpini, F Cavagnini and E. E. Muller. 2002. Plasma ghrelin concentrations in elderly subjects: comparison with anorexic and obese patients. J. Endocrinol. 175:R1-5.
Sakata, I., T. Tanaka, M. Matsubara, M. Yamazaki, S. Tani, Y. Hayashi, K. Kangawa and T. Sakai. 2002. Postnatal changes in ghrelin mRNA expression and in ghrelin-producing cells in the rat stomach. J. Endocrinol. 174:463-471.
Sugino, T., Y. Hasegawa, Y. Kikkawa, J. Yamaura, M. Yamagishi, Y. Kurose, M. Kojima, K. Kangawa and Y. Terashima. 2002a. A transient ghrelin surge occurs just before feeding in a scheduled meal-fed sheep. Biochem. Biophys. Res. Commun. 295:255-260.
Sugino, T., J. Yamaura, M. Yamagishi, Y. Kurose, M. Kojima, K. Kangawa, Y. Hasegawa and Y. Terashima. 2003. Involvement of cholinergic neurons in the regulation of the ghrelin secretory response to feeding in sheep. Biochem. Biophys. Res. Commun. 304:308-312.
Sugino, T., J. Yamaura, M. Yamagishi, A. Ogura, R. Hayashi, Y. Kurose, M. Kojima, K. Kangawa, Y. Hasegawa and Y. Terashima. 2002b. A transient surge of ghrelin secretion before feeding in modified by different feeding regimens in sheep.Biochem. Biophys. Res. Commun. 298:785-788.
Toshinai, K., M. S. Mondal, M. Nakazato, Y. Date, N. Murakami, M. Kojima, K. Kangawa and S. Matsukura. 2001. Upregulation of ghrelin expression in the stomach upon fasting, insulin-induced hypoglycemia and leptin administration. Biochem. Biophys. Res. Commun. 281:1220-1225.
Tschop, M., D. L. Smiley and M. L. Heiman. 2000. Ghrelin induces adiposity in rodents. Nature 407:908-913.
※ AI-Helper는 부적절한 답변을 할 수 있습니다.