최소 단어 이상 선택하여야 합니다.
최대 10 단어까지만 선택 가능합니다.
다음과 같은 기능을 한번의 로그인으로 사용 할 수 있습니다.
NTIS 바로가기국가/구분 | United States(US) Patent 등록 |
---|---|
국제특허분류(IPC7판) |
|
출원번호 | US-0879470 (1992-05-12) |
발명자 / 주소 |
|
출원인 / 주소 |
|
인용정보 | 피인용 횟수 : 11 인용 특허 : 0 |
Unique species-specific Eimeria necatrix DNA probes comprising divergent DNA sequences are disclosed. The probes are complementary to a small subunit ribosomal RNA gene of Eimeria necatrix.
A DNA probe, the DNA probe selected from the group consisting of 5′AAGTGATACAGTAATCGTGAAGTT 3′(SEQ ID NO: 17) and 5′CAAAACCAACCCACTTAACG 3′(SEQ ID NO: 38).
※ AI-Helper는 부적절한 답변을 할 수 있습니다.