$\require{mediawiki-texvc}$
  • 검색어에 아래의 연산자를 사용하시면 더 정확한 검색결과를 얻을 수 있습니다.
  • 검색연산자
검색도움말
검색연산자 기능 검색시 예
() 우선순위가 가장 높은 연산자 예1) (나노 (기계 | machine))
공백 두 개의 검색어(식)을 모두 포함하고 있는 문서 검색 예1) (나노 기계)
예2) 나노 장영실
| 두 개의 검색어(식) 중 하나 이상 포함하고 있는 문서 검색 예1) (줄기세포 | 면역)
예2) 줄기세포 | 장영실
! NOT 이후에 있는 검색어가 포함된 문서는 제외 예1) (황금 !백금)
예2) !image
* 검색어의 *란에 0개 이상의 임의의 문자가 포함된 문서 검색 예) semi*
"" 따옴표 내의 구문과 완전히 일치하는 문서만 검색 예) "Transform and Quantization"

통합검색

도움말도움말
상세검색 다국어 입력

연합인증

연합인증 가입 기관의 연구자들은 소속기관의 인증정보(ID와 암호)를 이용해 다른 대학, 연구기관, 서비스 공급자의 다양한 온라인 자원과 연구 데이터를 이용할 수 있습니다.

이는 여행자가 자국에서 발행 받은 여권으로 세계 각국을 자유롭게 여행할 수 있는 것과 같습니다.

연합인증으로 이용이 가능한 서비스는 NTIS, DataON, Edison 등이 있습니다.

한번의 인증절차만으로 연합인증 가입 서비스에 추가 로그인 없이 이용이 가능합니다.

다만, 연합인증을 위해서는 최초 1회만 인증 절차가 필요합니다. (회원이 아닐 경우 회원 가입이 필요합니다.)

연합인증 절차는 다음과 같습니다.

최초이용시에는
ScienceON에 로그인 → 연합인증 서비스 접속 → 로그인 (본인 확인 또는 회원가입) → 서비스 이용

그 이후에는
ScienceON 로그인 → 연합인증 서비스 접속 → 서비스 이용

연합인증을 활용하시면 KISTI가 제공하는 다양한 서비스를 편리하게 이용하실 수 있습니다.

특허 상세정보

MyON담기
내보내기 페이스북 공유 카카오톡 공유

erbB-2 gene segments, probes, recombinant DNA and kits for detection

특허상세정보
국가/구분 United States(US) Patent 등록
국제특허분류(IPC7판) C12Q-001/68   
미국특허분류(USC) 435/06 ; 435/069.1 ; 435/172.3 ; 435/320.1 ; 435/810 ; 436/501 ; 436/063 ; 536/023.1 ; 536/024.1 ; 536/024.3 ; 536/024.31 ; 536/024.32 ; 536/024.33 ; 935/077 ; 935/078
출원번호 US-0475035 (1995-06-07)
발명자 / 주소
  • King C. Richter
  • Kraus Matthias H.
  • Aaronson Stuart A.
출원인 / 주소
  • The United States of America as represented by the Department of Health and Human Services
대리인 / 주소
    Needle & Rosenberg, P.C.
인용정보 피인용 횟수 : 73  인용 특허 : 2
초록

The isolation, cloning and characterization of a human gene related to but distinct from the EGF receptor gene has been described. Nucleotide sequence of the gene and amino acid sequence of the polypeptide encoded by the gene have been determined. The use of the nucleic acid probes and antibodies having specific binding affinity with said polypeptide for diagnostic and therapeutic purposes has also been described.

대표
청구항
▼

[ We claim:] [1.] A purified nucleic acid which specifically hybridinzes to at least part of a MAC117 gene or nucleic acid derivative thereof and which does not hybridize to a nucleic acid encoding epidermal growth factor receptor under stringent conditions, wherein said MAC117 gene comprises the following sequence:GTCTACATGGGTGCTTCCCATTCCAGGGGATGAGCTACCTGGAGGATGTGCGGCTCG TACACAGGGACTTGGCCGCTCGGAACGTGCTGGTCAAGAGTCCCAACCATGTCAAA ATTACAGACTTCGGGCTGGCTCGGCTGCTGGACATTGACGAGACAGAGTACCATGC AGATGGGGGCAAGGTTAGGTGAAGGACCAAGGAGCAGAGGAGGCTGGGTGGAGTG GTGTCTAGCCCATGG...

이 특허에 인용된 특허 (2)

  1. Slamon Dennis J. (Woodland Hills CA) McGuire William L. (San Antonio TX), Determination of status in neoplastic disease.
  2. Frankel Arthur E. (Palo Alto CA) Ring David B. (Redwood City CA) Bjorn Michael J. (Hercules CA), Monoclonal anti-human breast cancer antibodies.

이 특허를 인용한 특허 (73)

  1. Bryant, John L., Adjuvant therapy with an anti-ERBB2 antibody conjugated to a maytansiniod.
  2. Bryant, John L., Anti-ERBB2 antibody adjuvant therapy.
  3. Fendly,Brian M., Anti-ErbB2 antibodies.
  4. Majumdar,Adhip P. N.; Sarkar,Fazlul H., Antibodies to a novel EGF-receptor related protein (ERRP).
  5. Clinton, Gail M., Compositions and methods for treating cancer by modulating HER-2 and EGF receptors.
  6. Clinton,Gail M., Compositions and methods for treating cancer by modulating HER-2 and EGF receptors.
  7. Cheever, Martin A; Disis, Mary L, Compounds for eliciting or enhancing immune reactivity to HER-2/neu protein for prevention or treatment of malignancies in which the HER-2/neu oncogene is associated.
  8. Cheever, Martin A; Disis, Mary L, Compounds for eliciting or enhancing immune reactivity to HER-2/protein for prevention or treatment of malignancies in which the HER-2/oncogene is associated.
  9. Mass, Robert D., Detection of ErbB2 gene amplification to increase the likelihood of the effectiveness of ErbB2 antibody breast cancer therapy.
  10. Baughman, Sharon A.; Shak, Steven, Dosages for treatment with anti-ErbB2 antibodies.
  11. Baughman,Sharon A.; Shak,Steven, Dosages for treatment with anti-ErbB2 antibodies.
  12. Freeman, Daniel J; Juan, Todd; Radinsky, Robert, Epidermal growth factor receptor mutations.
  13. Quinn, Thomas P.; Karasseva, Natalia G., Erb-2 receptor targeting peptide.
  14. Quinn, Thomas P.; Karasseva, Natalia G., ErbB-2 receptor targeting peptide.
  15. Baker, Joffre B.; Bryant, John L.; Paik, Soonmyung; Shak, Steven, Expression profile algorithm and test for cancer prognosis.
  16. Derynck, Mika K.; Kelsey, Stephen M., Extending time to disease progression or survival in cancer patients.
  17. Allison, David E.; Bruno, Rene; Lu, Jian-Feng; Ng, Chee M., Fixed dosing of HER antibodies.
  18. Allison,David E.; Bruno,Rene; Lu,Jian Feng; Ng,Chee M., Fixed dosing of HER antibodies.
  19. Mass, Robert D., Gene detection assay for improving the likelihood of an effective response to a HER2 antibody cancer therapy.
  20. Mass, Robert D., Gene detection assay for improving the likelihood of an effective response to a HER2 antibody cancer therapy.
  21. Mass, Robert D., Gene detection assay for improving the likelihood of an effective response to an EGFR antagonist cancer therapy.
  22. Cobleigh, Melody A.; Shak, Steve; Baker, Joffre B.; Cronin, Maureen T., Gene expression markers for breast cancer prognosis.
  23. Cobleigh, Melody A.; Shak, Steve; Baker, Joffre B.; Cronin, Maureen T., Gene expression markers for breast cancer prognosis.
  24. Cobleigh, Melody A.; Shak, Steve; Baker, Joffre B.; Cronin, Maureen T., Gene expression markers for breast cancer prognosis.
  25. Cobleigh, Melody A.; Shak, Steven; Baker, Joffre B.; Cronin, Maureen T., Gene expression markers for breast cancer prognosis.
  26. Cobleigh, Melody A.; Shak, Steven; Baker, Joffre B.; Cronin, Maureen T., Gene expression markers for breast cancer prognosis.
  27. Baker, Joffre B.; Shak, Steven; Gianni, Luca, Gene expression markers for predicting response to chemotherapy.
  28. Baker, Joffre B.; Shak, Steven; Gianni, Luca, Gene expression markers for predicting response to chemotherapy.
  29. Lee-Hoeflich, Si Tuen; Stern, Howard, Gene expression markers of tumor resistance to HER2 inhibitor treatment.
  30. Baker, Joffre B.; Cronin, Maureen T.; Kiefer, Michael C.; Shak, Steve; Walker, Michael Graham, Gene expression profiling in biopsied tumor tissues.
  31. Baker, Joffre B.; Cronin, Maureen T.; Kiefer, Michael C.; Shak, Steve; Walker, Michael Graham, Gene expression profiling in biopsied tumor tissues.
  32. Baker, Joffre B.; Cronin, Maureen T.; Kiefer, Michael C.; Shak, Steve; Walker, Michael Graham, Gene expression profiling in biopsied tumor tissues.
  33. Baker, Joffre B.; Cronin, Maureen T.; Shak, Steve; Baselga, Jose, Gene expression profiling of EGFR positive cancer.
  34. Baker, Joffre B.; Cronin, Maureen T.; Shak, Steven; Baselga, Jose, Gene expression profiling of EGFR positive cancer.
  35. Clinton, Gail M.; Evans, Adam; Henner, William D., HER-2 binding antagonists.
  36. Doherty,Joni Kristin; Clinton,Gail M.; Adelman,John P., HER-2 binding antagonists.
  37. Wicha, Max S.; Korkaya, Hasan, HER2 targeting agent treatment in non-HER2-amplified cancers having HER2 expressing cancer stem cells.
  38. Adams, Camellia W.; Presta, Leonard G.; Sliwkowski, Mark, Humanized anti-ERBB2 antibodies and treatment with anti-ERBB2 antibodies.
  39. Adams, Camellia W.; Presta, Leonard G.; Sliwkowski, Mark, Humanized anti-ErbB2 antibodies and treatment with anti-ErbB2 antibodies.
  40. Sliwkowski, Mark, Humanized anti-ErbB2 antibodies and treatment with anti-ErbB2 antibodies.
  41. Cheever, Martin A.; Disis, Mary L., Immune reactivity to HER-2/neu protein for diagnosis and treatment of malignancies in which the HER-2/neu oncogene is associated.
  42. Cheever,Martin A; Disis,Mary L, Immune reactivity to HER-2/neu protein for diagnosis and treatment of malignancies in which the HER-2/neu oncogene is associated.
  43. Cheever, Martin A; Disis, Mary L, Immune reactivity to HER-2/protein for diagnosis and treatment of malignancies in which the HER-2/oncogene is associated.
  44. Kuriyan, John; Zhang, Xuewu; Cole, Philip, Inhibitors of the EGFR kinase targeting the asymmetric activating dimer interface.
  45. Baker, Joffre B.; Bryant, John L.; Paik, Soonmyung; Shak, Steven, Molecular indicators of breast cancer prognosis and prediction of treatment response.
  46. Hudziak Robert M. ; Shepard H. Michael ; Ullrich Axel ; Fendly Brian M., Monoclonal antibodies directed to the HER2 receptor.
  47. Robert M. Hudziak ; H. Michael Shepard ; Axel Ullrich ; Brian M. Fendly, Monoclonal antibodies directed to the HER2 receptor.
  48. Robert M. Hudziak ; H. Michael Shepard ; Axel Ullrich ; Brian M. Fendly, Monoclonal antibodies directed to the HER2 receptor.
  49. Amler, Lukas C.; Birkner, Merrill; Lin, Chin-Yu; Moecks, Joachim; Strauss, Andreas, Predicting response to a HER inhibitor.
  50. Amler, Lukas C.; Birkner, Merrill; Lin, Chin-Yu; Moecks, Joachim; Strauss, Andreas, Predicting response to a HER inhibitor.
  51. Baker, Joffre B.; Bryant, John L.; Paik, Soonmyung; Shak, Steven, Predicting response to chemotherapy using gene expression markers.
  52. Baker, Joffre B.; Bryant, John L.; Paik, Soonmyung; Shak, Steven, Prediction of likelihood of cancer recurrence.
  53. Andya, James; Cleland, Jeffrey L.; Hsu, Chung C.; Lam, Xanthe M.; Overcashier, David E.; Shire, Steven J.; Yang, Janet Yu-Feng; Wu, Sylvia Sau-Yan, Protein formulation.
  54. Andya, James; Cleland, Jeffrey L.; Hsu, Chung C.; Lam, Xanthe M.; Overcashier, David E.; Shire, Steven J.; Yang, Janet Yu-Feng; Wu, Sylvia Sau-Yan, Protein formulation.
  55. Andya, James; Cleland, Jeffrey L.; Hsu, Chung C.; Lam, Xanthe M.; Overcashier, David E.; Shire, Steven J.; Yang, Janet Yu-Feng; Wu, Sylvia Sau-Yan, Protein formulation.
  56. Andya,James; Cleland,Jeffrey L.; Hsu,Chung C.; Lam,Xanthe M.; Overcashier,David E.; Shire,Steven J.; Yang,Janet Yu Feng; Wu,Sylvia Sau Yan, Protein formulation.
  57. Cleland, Jeffrey L.; Hsu, Chung C.; Lam, Xanthe M.; Overcashier, David E.; Yang, Janet Yu-Feng, Protein formulation.
  58. Majumdar, Adhip P. N., Recombinant DNA encoding an epidermal growth factor receptor related protein.
  59. Andya, James; Hsu, Chung C.; Shire, Steven J.; Wu, Sylvia Sau-Yan, Treating a mammal with a formulation comprising an antibody which binds IgE.
  60. Sliwkowski,Mark X., Treating prostate cancer with anti-ErbB2 antibodies.
  61. Baughman, Sharon A.; Shak, Steven, Treatment with anti-ErbB2 antibodies.
  62. Hellmann, Susan D., Treatment with anti-ErbB2 antibodies.
  63. Hellmann, Susan D., Treatment with anti-ErbB2 antibodies.
  64. Hellmann, Susan D., Treatment with anti-ErbB2 antibodies.
  65. Hellmann, Susan D., Treatment with anti-ErbB2 antibodies.
  66. Hellmann, Susan D., Treatment with anti-ErbB2 antibodies.
  67. Paton, Virginia E.; Shak, Steven; Hellmann, Susan D., Treatment with anti-ErbB2 antibodies.
  68. Sliwkowski, Mark, Treatment with anti-ErbB2 antibodies and EGFR-targeted drugs.
  69. Adams,Camellia W.; Presta,Leonard G.; Sliwkowski,Mark, Treatment with anti-ErbB2 antibodies and anti-hormonal compounds.
  70. Adams,Camellia W.; Presta,Leonard G.; Sliwkowski,Mark, Treatment with anti-ErbB2 antibodies and chemotherapeutic agents.
  71. Adams,Camellia W.; Presta,Leonard G.; Sliwkowski,Mark, Treatment with anti-ErbB2 antibody combinations.
  72. Kiefer, Michael C.; Hoyt, Kenneth W., Universal amplification of fragmented RNA.
  73. Scott, Randy; Baker, Joffre B.; Kiefer, Michael C., Use of intronic RNA to measure gene expression.

IPC 상위 출원인