$\require{mediawiki-texvc}$

연합인증

연합인증 가입 기관의 연구자들은 소속기관의 인증정보(ID와 암호)를 이용해 다른 대학, 연구기관, 서비스 공급자의 다양한 온라인 자원과 연구 데이터를 이용할 수 있습니다.

이는 여행자가 자국에서 발행 받은 여권으로 세계 각국을 자유롭게 여행할 수 있는 것과 같습니다.

연합인증으로 이용이 가능한 서비스는 NTIS, DataON, Edison, Kafe, Webinar 등이 있습니다.

한번의 인증절차만으로 연합인증 가입 서비스에 추가 로그인 없이 이용이 가능합니다.

다만, 연합인증을 위해서는 최초 1회만 인증 절차가 필요합니다. (회원이 아닐 경우 회원 가입이 필요합니다.)

연합인증 절차는 다음과 같습니다.

최초이용시에는
ScienceON에 로그인 → 연합인증 서비스 접속 → 로그인 (본인 확인 또는 회원가입) → 서비스 이용

그 이후에는
ScienceON 로그인 → 연합인증 서비스 접속 → 서비스 이용

연합인증을 활용하시면 KISTI가 제공하는 다양한 서비스를 편리하게 이용하실 수 있습니다.

Nucleotide sequences encoding osteogenic proteins 원문보기

IPC분류정보
국가/구분 United States(US) Patent 등록
국제특허분류(IPC7판)
  • C12N-015/63
  • C12N-015/18
출원번호 US-0375901 (1995-01-20)
발명자 / 주소
  • Oppermann Hermann
  • Kuberasampath Thangavel
  • Rueger David C.
  • Ozkaynak Engin
출원인 / 주소
  • Stryker Corporation
대리인 / 주소
    Testa, Hurwitz, Thibeault, LLP
인용정보 피인용 횟수 : 8  인용 특허 : 24

초록

Disclosed are 1) osteogenic devices comprising a matrix containing osteogenic protein and methods of inducing endochondral bone growth in mammals using the devices; 2) amino acid sequence data, amino acid composition, solubility properties, structural features, homologies and various other data char

대표청구항

[ What is claimed is:] [1.]1. A vector comprising the DNA sequence:(a) CTGTATGTCAGCTTCCGAGACCTGGGCTGGCAGGACTGGATCATCGCGCC TGAAGGCTACGCGCGCTACTACTGTGAGGGGGAGTGTGCCTTCCCTCTGA ACTCCTACATGAACGCCACCAACCACGCCATCGTGCAGACGCTGGTCCAC TTCATCAACCCGGAAACGGTGCCCAAGCCCTGCTGTGCGCCCACGCAGCT CAATGCCATCTCCGTCCTCTACTTC

이 특허에 인용된 특허 (24)

  1. Urist Marshall R. (Pacific Palisades CA), Biodegradable organic polymer delivery system for bone morphogenetic protein.
  2. Jefferies Steven R. (5802 Leith Walk Baltimore MD 21239), Bone graft material for osseous defects and method of making same.
  3. Urist Marshall R. (Pacific Palisades CA), Bone morphogenetic agents.
  4. Urist Marshall R. (Pacific Palisades CA), Bone morphogenetic protein.
  5. Urist Marshall R. (Pacific Palisade CA), Bone morphogenetic protein process.
  6. Wang Elizabeth A. (Carlisle MA) Wozney John M. (Hudson MA) Rosen Vicki (Brookline MA), DNA sequences encoding.
  7. Wozney John M. (Hudson MA) Rosen Vicki A. (Brookline MA) Wang Elizabeth A. (Carlisle MA), DNA sequences encoding 5 proteins.
  8. Wang Elizabeth A. (Carlisle MA) Wozney John M. (Hudson MA) Rosen Vicki (Brookline MA), DNA sequences encoding BMP-1 products.
  9. Wozney John M. (Hudson MA) Wang Elizabeth A. (Carlisle MA) Rosen Vicki A. (Brookline MA) Celeste Anthony J. (Hudson MA), DNA sequences encoding BMP-6 proteins.
  10. Rosen, Vicki A.; Wang, Elizabeth A.; Wozney, John M., DNA sequences encoding BMP-7 proteins.
  11. Wang Elizabeth A. (Carlisle MA) Wozney John M. (Hudson MA) Rosen Vicki (Brookline MA), DNA sequences encoding osteoinductive products.
  12. Wang Elizabeth A. (Carlisle MA) Wozney John M. (Hudson MA) Rosen Vicki A. (Brookline MA), DNA sequences encoding the osteoinductive proteins.
  13. Krger Wolfgang (Gttingen DEX) Mayer Hubert (Wolfenbttel DEX) Kukoschke Karl G. (Braunschweig DEX) Schlter Klaus D. (Braunschweig DEX) Delling Gnter (Braunschweig DEX), Growth-stimulating material derived from porcine bone therefor and a manufacturing process.
  14. Nathan Ranga (Newark CA) Seyedin Saied (Mountain View CA) Piez Karl (Menlo Park CA) Bentz Hanne (Palo Alto CA), Inductive collagen based bone repair preparations.
  15. Oppermann Hermann (Medway MA) Dorai Haimanti (Lexington MA) Kaplan Paul (Auburndale MA), Methods and compositions for high protein production from recombinant DNA.
  16. Wozney John M. (Hudson MA) Wang Elizabeth A. (Carlisle MA) Rosen Vicki A. (Brookline MA), Methods for producing BMP-7 proteins.
  17. Oppermann Hermann (Medway MA) Ozkaynak Engin (Milford MA) Rueger David C. (Hopkinton MA) Kuberasampath Thangavel (Medway MA), Osteogenic devices.
  18. Parsons Thomas F. (Arcadia CA) Sen Arup (Van Nuys CA) Grinna Lynn (Santa Monica CA) Hersh Carol (Great Neck NY) Theofan Georgia (Los Angeles CA), Osteogenic factors.
  19. Sen Arup (Los Angeles CA), Osteogenic factors.
  20. Wang Elizabeth A. (Carlisle MA) Wozney John M. (Hudson MA) Rosen Vicki (Boston MA), Osteoinductive factors.
  21. Seyedin Saeid (Mt. View CA) Thomas Thomas (Palo Alto CA), Partially purified osteogenic factor and process for preparing same from demineralized bone.
  22. Seyedin Saeid (Sunnyvale CA) Thomas Thomas (Concord CA) Bentz Hanne (Palo Alto CA) Ellingsworth Larry (San Jose CA) Armstrong Rosa (Palo Alto CA), Polypeptide cartilage-inducing factors found in bone.
  23. Seyedin Saeid (Sunnyvale CA) Thomas Thomas (Davis CA) Bentz Hanne (Palo Alto CA) Ellingsworth Larry (San Jose CA) Armstrong Rosa (Palo Alto CA), Polypeptide cartilage-inducing factors found in bone.
  24. Seyedin Saeid (Sunnyvale CA) Thomas Thomas (Davis CA) Bentz Hanne (Palo Alto CA) Ellingsworth Larry (San Jose CA) Armstrong Rosa (Palo Alto CA), Polypeptide cartilage-inducing factors found in bone.

이 특허를 인용한 특허 (8)

  1. Kohnert, Ulrich; Pohling, Sylke; Hellerbrand, Klaus; Happersberger, Peter, Device having osteoinductive and osteoconductive properties.
  2. Hellerbrand, Klaus; Beaucamp, Nicola; Kohnert, Ulrich, Metal implant coated under reduced oxygen concentration with osteoinductive protein.
  3. Hellerbrand, Klaus; Beaucamp, Nicola; Kohnert, Ulrich, Metal implant coated under reduced oxygen concentration with osteoinductive protein.
  4. Oppermann, Hermann; Ozkaynak, Engin; Kuberasampath, Thangavel; Rueger, David C.; Pang, Roy H. L., Method of using recombinant osteogenic protein to repair bone or cartilage defects.
  5. Oppermann,Hermann; Kuberasampath,Thangavel; Rueger,David C.; Ozkaynak,Engin, Nucleic acid molecules encoding osteogenic proteins.
  6. Oppermann,Hermann; Kuberasampath,Thangavel; Rueger,David C.; Ozkaynak,Engin, Nucleic acid molecules encoding osteogenic proteins.
  7. Oppermann,Hermann; Ozkaynak,Engin; Kuberasampath,Thangavel; Rueger,David C.; Pang,Roy H. L., Osteogenic proteins.
  8. Sebald,Walter, Polypeptide variants with increased heparin-binding capacity.
섹션별 컨텐츠 바로가기

AI-Helper ※ AI-Helper는 오픈소스 모델을 사용합니다.

AI-Helper 아이콘
AI-Helper
안녕하세요, AI-Helper입니다. 좌측 "선택된 텍스트"에서 텍스트를 선택하여 요약, 번역, 용어설명을 실행하세요.
※ AI-Helper는 부적절한 답변을 할 수 있습니다.

선택된 텍스트

맨위로