초록 ▼

A system for the rapid characterization of multi-analyte fluids, in one embodiment, includes a light source, a sensor array, and a detector. The sensor array is formed from a supporting member into which a plurality of cavities may be formed. A series of chemically sensitive particles are, in one em

A system for the rapid characterization of multi-analyte fluids, in one embodiment, includes a light source, a sensor array, and a detector. The sensor array is formed from a supporting member into which a plurality of cavities may be formed. A series of chemically sensitive particles are, in one embodiment positioned within the cavities. The particles may be configured to produce a signal when a receptor coupled to the particle interacts with the analyte. Using pattern recognition techniques, the analytes within a multi-analyte fluid may be characterized.

대표청구항 ▼

A system for the rapid characterization of multi-analyte fluids, in one embodiment, includes a light source, a sensor array, and a detector. The sensor array is formed from a supporting member into which a plurality of cavities may be formed. A series of chemically sensitive particles are, in one em

A system for the rapid characterization of multi-analyte fluids, in one embodiment, includes a light source, a sensor array, and a detector. The sensor array is formed from a supporting member into which a plurality of cavities may be formed. A series of chemically sensitive particles are, in one embodiment positioned within the cavities. The particles may be configured to produce a signal when a receptor coupled to the particle interacts with the analyte. Using pattern recognition techniques, the analytes within a multi-analyte fluid may be characterized. 1983, "Easy identification of cDNA clones", EMBO Journal 2(10):1791-1794. Santerre et al, 1984, "Expression of prokaryotic genes for hygromycin B and G418 resistance as dominant-selection markers in mouse L cells", Gene 30:147-156. Sarin et al, 1988, "Inhibition of acquired immunodeficiency syndrome virus by oligodeoxynucleoside methylphosphonates", Proc. Natl. Acad. Sci. USA 85:7448-7451. Smith et al, 1983, "Molecular Engineering of the Autographa californica Nuclear Polyhedrosis Virus Genome: Deletion Mutations within the Polyhedrin Gene", J. Virol. 46(2):584-593. Stein et al, 1988, "Physiochemical properties of phosphorothioate oligodeoxynucleotides", Nucleic Acids Research 16(8):3209-3221. Szybalska & Szybalski, 1962, "Genetics of Human Cell Lines, IV. DNA-Mediated Heritable Transformation of a Biochemical Trait", Proc. Natl. Acad. Sci. USA 48:2026-2034. Takeda et al, 1985, "Construction of chimaeric processed immunoglobulin genes containing mouse variable and human constant region sequences", Nature 314:452-454. Van Heeke et al, 1989, "Expression of Human Asparagine Synthetase in Escherichia coli", J. Biol. Chemistry 264(10):5503-5509. Ward et al, 1989, "Binding activities of a repertoire of single immunoglobulin variable domains secreted from Escherichia coli", Nature 341:544-546. Wigler et al, 1977, "Transfer of Purified Herpes Virus Thymidine Kinase Gene to Cultured Mouse Cells", Cell 11:223-232. Wigler et al, 1980, "Transformation of mammalian cells with an amplifiable dominant-acting gene", Proc. Natl. Acad. Sci. USA 77(6):3567-3570. Database EMBL `Online` accession No. P05790, Nov. 1, 1988, Zhou et al. "Bombyx mori fibroin heavy chain precursor," XP002167584, abstract. Database EMBL `Online` accession No. 053559, Jun. 1, 1998, Cole et al., "Mycrobacterium tuberculosis PGRS-family protein," XP002167585, asbtract. Database EMBL Online accession No. 076786, Nov. 1, 1998, Sezutsu et al, "Antheraea pernyi (Chinese oak silk moth) fibroin gene," XP002167586, abstract. International Search Report, International Application No. PCT/US00/33240, Dec. 7, 2000. ides and nucleotide sequences encoding them are provided. Recombinant host cells, expression vectors and methods for the recombinant production of phenolic acid esterases are also provided. Further provided are methods for improving nutrient availability and ferulic acid availability when food or feed, or other material is treated with a phenolic acid esterase, desirably in combination with a xylanase. omoter sequence, a polyT sequence, and a test specificity determining box between the partial RNA polymerase promoter sequence and the polyT sequence. 8. The method of claim 7, wherein the partial RNA polymerase promoter sequence is from an RNA polymerase promoter selected from the group consisting of: SP6, T3 or T7 RNA polymerase promoter. 9. The method of claim 7, wherein the polyT sequence contains approximately 15-50 T. 10. The method of claim 9, wherein the polyT sequence contains approximately 24 T. 11. The method of claim 7, wherein the first strand 5' cDNA primer sequence comprising a test specificity determining box comprises CTCACTATAGGGAGGCGGCAGCT(T)24VN (SEQ ID NO:2). 12. The method of claim 1, wherein the amplification conditions for polymerase chain reaction comprise using universal primers which specifically bind to the 5' first strand cDNA primer sequences and to the 3' first strand cDNA primer sequences of both the reference nucleic acid and the test RNA. 13. The method of claim 12, wherein the universal primers comprise CGACTCACTATAGGGAGGCGG (SEQ ID NO:4) and AAGCAGTGGTAACAACGCACACT (SEQ ID NO:5). 14. The method of claim 1, wherein the amplification conditions for polymerase chain reaction compr