Problem The purpose of the present invention is to provide: a stereo isomer of a novel CpG oligonucleotide, which has excellent stability; and a CpG oligonucleotide which has a capability of producing interferon-α (IFNα). Solution The present invention relates to an oligonucleotide which contains tw
Problem The purpose of the present invention is to provide: a stereo isomer of a novel CpG oligonucleotide, which has excellent stability; and a CpG oligonucleotide which has a capability of producing interferon-α (IFNα). Solution The present invention relates to an oligonucleotide which contains two to four sequences each represented by the formula 5′-X1X2CpGX3X4-3′ (formula (I)) and has a length of 14 to 32 nucleotides. In formula (I), CpG represents a non-methylated CpG residue having a phosphate skeleton modification, X1X2 represents any one of AA, AT, GA and GT, and X3X4 represents any one of TT, AT, AC and CG. The oligonucleotide has at least one phosphate skeleton modification at an S-form stereoisomer located at a site other than the CpG.
대표청구항▼
1. An oligonucleotide which comprises two to four sequences each represented by 5′-X1X2CpGX3X4-3′ and has a length of 14 to 32 nucleotides, wherein the CpG is non-methylated CpG without a modified phosphate backbone,wherein X1X2 is AA, AT, GA, or GT, and contains no modified phosphate backbones,wher
1. An oligonucleotide which comprises two to four sequences each represented by 5′-X1X2CpGX3X4-3′ and has a length of 14 to 32 nucleotides, wherein the CpG is non-methylated CpG without a modified phosphate backbone,wherein X1X2 is AA, AT, GA, or GT, and contains no modified phosphate backbones,wherein X3X4 is TT, AT, AC, TC, or CG, and contains no modified phosphate backbones, andthe oligonucleotide comprises at least one modified phosphate backbone at a site other than the parts represented by 5′-X1X2CpGX3X4-3′. 2. An oligonucleotide which comprises two to four sequences each represented by 5′-X1X2CpGX3X4-3′ and has a length of 14 to 32 nucleotides, wherein the CpG is non-methylated CpG without a modified phosphate backbone,wherein X1X2 is AA, AT, GA, or GT, and may comprise a modified phosphate backbone,wherein X3X4 is TT, AT, AC, TA, TC, or CG, and may comprise a modified phosphate backbone, and wherein the oligonucleotide comprises at least one Sp modified phosphate backbone at a site other than the parts represented by 5′-X1X2CpGX3X4-3′. 3. An oligonucleotide which comprises two to four sequences each represented by 5′-X1X2CpGX3X4-3′ and has a length of 14 to 32 nucleotides, wherein the CpG is non-methylated CpG without a modified phosphate backbone,wherein X1X2 is AA, AT, GA, or GT, and may comprise a modified phosphate backbone,wherein X3X4 is TT, AT, AC, TA, TC, or CG, and may comprise a modified phosphate backbone, andthe oligonucleotide comprises at least one modified phosphate backbone at a site other than the parts represented by 5′-X1X2CpGX3X4-3′; andwherein the oligonucleotide comprises one of the following sequences: SEQ No.Sequence 1T*C*GTCGTT*T*T*GTCGTT*T*T*GTCGGG 2G*G*GTCGTT*T*T*GTCGTT*T*T*GTCGGG 3T*C*AACGTT*T*C*AACGTT*T*T 4T*C*AACGTT*T*C*AACGTT*T*T*GG 5T*C*AACGTT*T*C*AACGTT*G*G 6T*C*AACGTT*T*C*AACGTT*G*G*G*G 7T*C*AACGTT*T*T*AACGTT*T*T*AACGGG 8T*C*AACGTT*T*A*ACGTT*T*T 9T*C*AACGT*TAACGTT*T*T 10T*C*AACGTT*T*A*AACGTT*T*A*AACGGG 11T*C*AACGTTAACGTTAACGGG 12T*C*GACGTT*T*T*GACGTT*T*T*GACGGG 15G*G*GACGT*T*T*TGACGT*T*T*TGACGGGGG 16T*C*GACGT*T*T*TGACGT*T*T*TGACGT*T*T*TGACGGG 17T*C*GACGT*T*GACGT*T*GACGGG 20T*C*GACGT*T*GACGT*T*GACGT*T*GACGGG 21T*C*GACGTT*T*A*AACGTT*T*A*AACGTT*T*A*AACGGG 22T*C*GACGTT*T*A*AACGTT*T*A*GACGTT*T*A*AACGGG 23T*C*GACGTTAACGTTAACGTTAACGGG 24GGGACGTT*T*A*AACGTCTAGACGGG 25T*C*GACGT*ACGT*ACGT*ACGGG 26T*C*GACGTT*T*T*GACGTT*T*T*G*A*C*G*G*G 29T*C*GACGTT*T*T*GACGTT*T*T*GACGG*G*G 30T*C*GACGTT*T*T*GACGTT*T*T*GACGT*G*G 31T*C*GACGTT*T*T*GACGTT*T*T*GACGTG*G*G 32T*C*GACGTT*T*T*GACGTT*T*T*G*A*C*G*G*G 33T*C*GACGTT*T*T*GACGTT*T*T*GACGG*G*G*G*G 36T*C*GACGTT*T*T*GACGTT*T*T*GACG*G*G*G*G 37T*C*GACGT*T*GACGT*T*GACGTG*G*G 38G*G*T*G*C*ATCGAT*G*C*A*G*G*G*G*G*G 39T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGGG 40G*G*T*G*C*GACGAT*G*C*A*G*G*G*G*G*G 41G*G*G*G*GACGATCGTCGGG*G*G*G 42G*G*GACGATATCGTCG*G*G*G*G*G 43G*G*GACGACGTCGTCG*G*G*G*G*G 46G*G*GGGACGATCGTCG*G*G*G*G*G 47G*G*GACGCGCGTCG*G*G*G*G*G*G*G 48G*G*G*G*TCGTTCG*G*G*G 49T*C*ATCGAT*T*T*ATCGAT*T*T*A*A*C*G*G*G 50T*C*GACGTTTTGACGTT*T*T*G*A*C*G*G*G 51T*C*GACGTTTTGACGTTTT*G*A*C*G*G*G 52T*C*GACGT*T*GACGT*T*GACGG*G 53TC*GACGT*T*GACGT*T*GACG*G*G 54T*C*GACGT*T*GACGT*T*GACGG*G*G 55T*C*GACGT*T*GACGT*T*GACT*G 56T*C*GACGT*T*GACGT*T*G*A*C*G*G*G 57T*C*GACGTTGACGT*T*G*A*C*G*G*G 58T*C*ATCGATATCGA*T*G*A*C*G*G*G 59T*C*GACGT*T*GACGT*T*GACG*G*G*G 60T*C*GACGTT*T*T*GACGTT*T*T*G*G*G*G*G 61T*C*GACGTT*T*T*GACGTT*T*T*G*A*G*G*G*G 62T*C*GACGTT*T*T*GACGTT*T*T*G*T*G*G*G*G 63T*C*G*ACGTT*G*ACGTT*G*A*C*G*G*G 64C*C*GACGTT*T*T*GACGTT*T*T*GACG*G*G 65T*C*GACGTT*T*A*GACGTT*T*A*GACG*G*G 66T*C*GACGTT*T*T*GACGTT*T*T*GACG*A*A 67T*C*GACGTT*T*T*GACGTT*T*T*GACG*T*T 68T*C*AACGTT*T*T*AACGTT*T*T*GACG*G*G 69T*C*GACGTT*T*T*GACGTT*T*T*GGG 70T*C*GACGTT*T*T*GACGTT*T*T*GACGTTGG 71T*C*GACGTT*GACGTT*G*G*G 72T*C*GACGTT*T*T*T*ACGTT*T*T*G*ACG*G*G 73T*C*G*A*CGTT*T*T*ACGTTTTGACGGG 74T*C*G*ACGTT*T*T*G*ACGTT*T*T*G*ACG*G*G 75T*C*GACGTA*GACGTA*GACG*G*G 76T*A*GACGAT*T*C*GTCGTC*T*A*GACG*G*G 77T*A*GACGA*C*GTCGT*A*GACC*G*G 78T*C*G*ACGTTT*T*G*ACGTT*T*T*G*A*C*G*G*G 79T*C*G*ACGTT*T*T*T*A*ACGAC*T*T*G*A*C*G*G*G 80T*C*G*ACGTTT*T*AACGAC*T*T*G*A*C*G*G*G 81T*C*ATCGAT*T*T*ATCGAT*T*T*GACG*G*G 82T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGA*T*G*G*G 83T*C*ATCGAT*T*T*ATCGAT*T*T*AT*C*G*G*G 84T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGAT*T*T*ATCG*G*G 85T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGAT*T*T*A*T*C*G*G*G 86T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGAT*A*T*C*G*G*G 87T*T*ATCGAT*T*T*ATCGAT*T*T*G*A*C*G*G*G 88T*C*ATCGATATCGAT*T*T*G*A*C*G*G*G 89TCATCGAT*T*T*ATCGAT*T*T*A*T*C*G*G*G 90T*C*ATCGAT*T*T*ATCGAT*T*T*G*A*C*G*A*T 91T*C*GACGT*T*GACGT*T*GACGT*T*G*G*G 92T*C*G*ACGT*T*G*ACGT*T*G*A*C*G*G*G 93T*C*A*TCGAT*T*T*A*TCGAT*T*T*G*A*C*G*G*G 94T*C*A*TCGAT*A*TCGAT*G*ACGT*T*T*G*G*G 95T*C*GACGTTTGACGTTT*G*A*C*G*G*G 96T*C*ATCGAT*T*T*ATCGAT*T*T*A*T*C*G*G*G 97G*G*GACGATATCGTCG*G*G*G*G*G 98G*G*GACGAC*G*TCGTCG*G*G*G*G*G 99G*G*GACGACGTCGTCG*G*G*G*G100T*C*GACGACGTCGTCG*G*G*G*G*G101T*C*GACGACGTCGTCT*T*T*G*G*G102T*A*GACGACGTCGTCT*T*T*G*G*G103T*T*GACGACGTCGTCA*A*A*G*G*G104T*C*GACGTAGACGTCT*T*T*G*G*G105T*C*GACGTAGACGTTT*A*G*G*G*G106T*C*ATCGATATCGATT*T*T*G*G*G107T*T*ATCGATATCGATA*A*A*G*G*G108T*C*GACGTAGACGATCGA*T*G*G*G109T*C*GACGAC*T*T*GACGAC*T*T*G*A*C*G*G*G110T*C*GACGAC*T*T*GTCGTC*T*T*G*A*C*G*G*G111T*T*ATCGATATCGATA*T*C*G*A*T*G*G*G112T*T*ATCGATATCGATT*T*A*A*A*G*G*G113T*C*ATCGAT*T*T*ATCGAT*T*T*G*A*C*G*T*T114T*C*ATCGA*T*ATCGA*T*G*A*C*G*G*G*G115T*C*ATCGAT*ATCGA*T*G*G*G116T*C*GTCGTTGTCGT*T*G*A*C*G*G*G117T*C*G*TCGTT*T*T*G*TCGTT*T*T*G*A*C*G*G*G118T*C*GTCGTTGTCGTTG*A*C*G*A*C*G*G*Gwherein in the above formula, * refers to a modified phosphate backbone and at least one * in each formula is Sp, andin the above formula, CG at a site corresponding to 5′-X1X2CpGX3X4-3′ means non-methylated CpG without a modified phosphate backbone. 4. An oligonucleotide which comprises two to four sequences each represented by 5′-X1X2CpGX3X4-3′ and has a length of 14 to 32 nucleotides, wherein the CpG is non-methylated CpG without a modified phosphate backbone,wherein X1X2 is AA, AT, GA, or GT, and may comprise a modified phosphate backbone,wherein X3X4 is TT, AT, AC, TA, TC, or CG, and may comprise a modified phosphate backbone,wherein the oligonucleotide comprises at least one modified phosphate backbone at a site other than the parts represented by 5′-X1X2CpGX3X4-3′, andwherein the oligonucleotide comprises a sequence represented as -(G)m-, wherein m is an integer of 1 to 6, at 3′ end side of a CpG motif, the CpG motif being 5′-X1X2CpGX3X4-3′. 5. An oligonucleotide which comprises two to four sequences each represented by 5′-X1X2CpGX3X4-3′ and has a length of 14 to 32 nucleotides, wherein the CpG is non-methylated CpG without a modified phosphate backbone,wherein X1X2 is AA, AT, GA, or GT, and may comprise a modified phosphate backbone,wherein X3X4 is TT, AT, AC, TA, TC, or CG, and may comprise a modified phosphate backbone,wherein the oligonucleotide comprises at least one modified phosphate backbone at a site other than the parts represented by 5′-X1X2CpGX3X4-3′, andwherein the oligonucleotide comprises a sequence represented as TC, TA, TG, CC or CC at 5′ end side of a CpG motif, the CpG motif being the sequence of 5′-X1X2CpGX3X4-3′. 6. An oligonucleotide which comprises two to four sequences each represented by 5′-X1X2CpGX3X4-3′ and has a length of 14 to 32 nucleotides, wherein the CpG is non-methylated CpG without a modified phosphate backbone,wherein X1X2 is AA, AT, GA, or GT, and may comprise a modified phosphate backbone,wherein X3X4 is TT, AT, AC, TA, TC, or CG, and may comprise a modified phosphate backbone,wherein the oligonucleotide comprises at least one modified phosphate backbone at a site other than the parts represented by 5′-X1X2CpGX3X4-3′, andwherein the oligonucleotide comprises at least a first CpG motif and a second CpG motif, the first and the second CpG motifs being 5′-X1X2CpGX3X4-3′,wherein the first CpG motif and the second CpG motif are bonded directly with no sequence between them, orwherein the oligonucleotide comprises a sequence represented as -(T)n-, wherein n is an integer of 1 to 3, TA or TC between the first CpG motif and the second CpG motif. 7. The oligonucleotide as claimed in claim 3, wherein the oligonucleotide comprises a sequence selected from Sequence Nos. 12, 17, 78, 43, 60, 67, 102, 103, 112 and 116.
연구과제 타임라인
LOADING...
LOADING...
LOADING...
LOADING...
LOADING...
이 특허에 인용된 특허 (300)
Yadav,Narendra S.; Zhang,Hongxiang, Δ-12 desaturase gene suitable for altering levels of polyunsaturated fatty acids in oleaginous yeasts.
Huynh Dinh Tam (Croissy/Seine FRX) Gouyette Catherine (Vanves FRX) Igolen Jean (Le Mesnil St. Denis FRX), 2,N6-disubstituted and 2,N6-trisubstituted adenosine-3′-phosphoramidites.
Kashi Yechezkel,ILX ; Gur-Arie Riva,ILX ; Cohen Cyril,ILX ; Eitan Yuval,ILX ; Shelef Leora ; Hallerman Eric, Abundant, well distributed and hyperpolymorphic simple sequence repeats in prokaryote genomes and use of same for prokaryote classification and typing.
Yao, Wenqing; Zhuo, Jincong; Xu, Meizhong; Metcalf, Brian W.; He, Chunhong; Qian, Ding-Quan; Zhang, Colin, Amido compounds and their use as pharmaceuticals.
Yao, Wenqing; Zhuo, Jincong; Xu, Meizhong; Metcalf, Brian W.; He, Chunhong; Qian, Ding-Quan; Zhang, Colin, Amido compounds and their use as pharmaceuticals.
Yao, Wenqing; Zhuo, Jincong; Xu, Meizhong; Zhang, Colin; Metcalf, Brian W.; He, Chunhong; Qian, Ding-Quan, Amido compounds and their use as pharmaceuticals.
George, Dawn M.; Dixon, Richard W.; Friedman, Michael; Hobson, Adrian D.; Li, Biqin; Wang, Lu; Wu, Xiaoyun; Wishart, Neil, Aminopyrrolidines as chemokine receptor antagonists.
C. Frank Bennett ; Nicholas M. Dean ; Phillip Dan Cook ; Glenn Hoke, Antisense oligonucleotides which have phosphorothioate linkages of high chiral purity and which modulate .beta.I, .beta.II, .gamma., .delta., .EPSILON., .zeta. and .eta. isoforms of human protein kin.
Andrus William A. (San Francisco CA) McCollum Christie D. (Foster City CA) Zon Gerald (San Carlos CA), Automated system for polynucleotide synthesis and purification.
Andrus William A. (San Francisco CA) McCollum Christie D. (Foster City CA) Zon Gerald (San Carlos CA), Automated system for polynucleotide synthesis and purification.
Gopalan, Venkat; Jovanovic, Milan; Eder, Paul S.; Giordano, Tony; Powers, Gordon D.; Xavier, K. Asish, Bacterial RNase P proteins and their use in identifying antibacterial compounds.
Spielvogel Bernard F. (Raleigh NC) Sood Anup (Durham NC) Hall Iris H. (Chapel Hill NC) Ramsay Shaw Barbara (Durham NC), Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same.
Suhadolnik Robert J. (Roslyn PA) Pfleiderer Wolfgang (Constance DEX), Cholesterol conjugates of 2′5′-oligoadenylate derivatives and antiviral uses thereof.
Bhanot, Sanjay; Geary, Richard S.; McKay, Robert; Monia, Brett P.; Seth, Punit P.; Siwkowski, Andrew M.; Swayze, Eric E.; Wancewicz, Edward, Compounds and methods for modulating expression of GCGR.
Bhanot, Sanjay; Geary, Richard S.; McKay, Robert; Monia, Brett P.; Seth, Punit P.; Siwkowski, Andrew M.; Swayze, Eric; Wancewicz, Edward, Compounds and methods for modulating expression of PCSK9.
Barany, Francis; Gerry, Norman P.; Witowski, Nancy E.; Day, Joseph; Hammer, Robert P.; Barany, George, Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays.
St. Clair Daret K. ; Urano Muneyasu,JPX ; Kasarskis Edward J., Diagnostic test and therapy for manganese superoxide dismutate (mNsod) associated diseases.
Domagala John M. (Canton MI) Prugh Susan E. (Ann Arbor MI) Sanchez Joseph P. (Canton MI) Solomon Marjorie S. (Ann Arbor MI), Disubstituted-7-pyrrolidinonaphthyridine antibacterial agents.
Froehler Brian (Belmont CA) Matteucci Mark (Burlingame CA), Enhanced triple-helix and double-helix formation with oligomers containing modified purines.
Brian Froehler ; Rick Wagner ; Mark Mattencci ; Robert J. Jones ; Arnold J. Gutierrez ; Jeff Pudlo, Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines.
Suckow, Mark A.; Wolter, William R.; Hall, Paul, Extracellular matrix materials as vaccine adjuvants for diseases associated with infectious pathogens or toxins.
Van De Grampel Hendrik T. (Bergen Op Zoom NLX) Hou Yongsheng (Pittsburgh PA) Spencer Dennis O. (Shelby NC) Swisher Robert G. (Pittsburgh PA) Thimons Thomas V. (Allison Park PA), Fiber reinforced functionalized polyolefin composites.
Cho, Joong Myung; Lee, Yong Beom; Park, Young Woo; Lim, Kook Jin; Choi, Deog Young; So, Hong Seob; Kim, Chun Hyung; Kim, Sung Taek; Yang, Jae Young, Hepatitis C diagnostics and vaccines.
Perera, Ranjan; Koo, Seongjoon; Dean, Nicholas M.; Marcusson, Eric G., Identification of novel pathways, genes and promoter motifs regulating adipogenesis.
Rogers Thomas E. (Manchester MO) Gray Steven H. (Ellisville MO) Devadas Balekudru (Chesterfield MO) Adams Steven P. (St. Charles MO), Improved probes using nucleosides containing 3-dezauracil analogs.
Garza Gonzalez, Elvira; Bosques Padilla, Francisco Javier; Moreno Campana, Victor Manuel, Method for detection and multiple, simultaneous quantification of pathogens by means of real-time polymerase chain reaction.
Benner Steven A. (Hadlaubstrasse 151 CH-8006 Zurich CHX), Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases.
Stec Wojciech J. (Lodz PLX) Grajkowski Andrzej (Lodz PLX) Uznanski Bogdan (Lodz PLX), Method of making oligonucleotides and oligonucleotide analogs using phospholanes and enantiomerically resolved phosphola.
Dalb.o slashed.ge Henrik,DKX ; Sandal Thomas,DKX ; Kauppinen Markus Sakari,DKX ; Diderichsen B.o slashed.rge,DKX, Method of providing a hybrid polypeptide exhibiting an activity of interest.
Hartmann, Gunther; de Fougerolles, Antonin; Hornung, Veit; Endres, Stefan, Method of stimulating an immune response and inhibiting expression of a gene using an oligonucleotide.
Stec Wojciech J. (Lodz PLX) Uznanski Bogdan (Lodz CA PLX) Bergot B. John (Redwood City CA) Hirschbein Bernard L. (San Francisco CA) Fearon Karen L. (Union City CA), Method of synethesizing sulfurized oligonucleotide analogs.
Stec Wojciech J. (Lodz PLX) Uznanski Bogdan (Lodz CA PLX) Bergot B. John (Redwood City CA) Hirschbein Bernard L. (San Francisco CA) Fearson Karen L. (Union City CA), Method of synthesizing sulfurized oligonucleotide analogs.
Helliwell, Christopher A.; Wesley, Susan V.; Waterhouse, Peter M., Methods and means for producing efficient silencing construct using recombinational cloning.
Helliwell, Christopher A.; Wesley, Susan V.; Waterhouse, Peter M., Methods and means for producing efficient silencing construct using recombinational cloning.
Helliwell, Christopher A.; Wesley, Susan V.; Waterhouse, Peter M., Methods and means for producing efficient silencing construct using recombinational cloning.
Freier, Susan M.; Crooke, Rosanne M.; Graham, Mark J.; Lemonidis, Kristina L.; Bhanot, Sanjay; Tribble, Diane; Watt, Andrew T., Methods for treating hypercholesterolemia.
Chang, Jin Sook; Jo, Jae Hyun; Bae, Hyun Ae; Song, Byeong Cheol; Kim, Sol; Kim, Hye Won, Microorganism producing O-phosphoserine and method of producing L-cysteine or derivatives thereof from O-phosphoserine using the same.
Hung, Gene; Bennett, C. Frank; Freier, Susan M.; Kordasiewicz, Holly; Stanek, Lisa; Cleveland, Don W.; Cheng, Seng H.; Shihabuddin, Lamya, Modulation of huntingtin expression.
Hanecak,Ronnie C.; Anderson,Kevin P.; Bennett,C. Frank; Chiang,Ming Yi; Brown Driver,Vickie L.; Ecker,David J.; Vickers,Timothy A.; Wyatt,Jacqueline R., Modulation of telomere length by oligonucleotides having a G-core sequence.
Garvey,David S.; Letts,L. Gordon; Renfroe,H. Burt; Richardson,Stewart K., Nitrosated and nitrosylated compounds and compositions and their use for treating respiratory disorders.
Domagala John M. (Canton MI) Hagen Susan E. (Ypsilanti MI) Sanchez Joseph P. (Canton MI) Solomon Marjorie S. (Bellevue WA), Novel disubstituted-7-pyrrolidinoquinoline antibacterial agents.
Cook Philip D. (Carlsbad CA) Sanghvi Yogesh S. (San Marcos CA), Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression.
Bennett, C. Frank; Freier, Susan M.; Griffey, Richard H.; Marcusson, Eric G., Oligomeric compounds and compositions for use in modulation of small non-coding RNAs.
Esau, Christine; Lollo, Bridget; Bennett, C. Frank; Freier, Susan M.; Griffey, Richard H.; Baker, Brenda F.; Vickers, Timothy A.; Marcusson, Eric G.; Koller, Erich; Swayze, Eric E.; Jain, Ravi; Bhat, Balkrishen; Peralta, Eigen, Oligomeric compounds and compositions for use in modulation of small non-coding RNAs.
Lollo, Bridget; Bennett, C. Frank; Freier, Susan M.; Griffey, Richard H., Oligomeric compounds and compositions for use in modulation of small non-coding RNAs.
Cook Phillip Dan ; Sanghvi Yogesh S. ; Sprankle Kelly G. ; Ross Bruce S. ; Griffey Rich H., Oligomeric compounds having pyrimidine nucleotide (S) with 2'and 5 substitutions.
Lin, Hui-Ling; Liang, Teh-Ming; Chang, Tsung Chain; Cheng, Sheng-Shung, Oligonucleotide sequences and DNA chip for identifying filamentous microorganisms and the identification method thereof.
Cook Phillip Dan (San Marcos CA) Hoke Glenn (Mt. Airy MD), Oligonucleotides for modulating Ha-ras or Ki-ras having phosphorothioate linkages of high chiral purity.
Cook Phillip Dan (San Marcos CA) Hoke Glenn (Mt. Airy MD), Oligonucleotides for modulating RAF kinase having phosphorothioate linkages of high chiral purity.
Cook Phillip D. (San Marcos CA) Hoke Glenn (Mt. Airy MD), Oligonucleotides for modulating cytomegalovirus having phosphorothioate linkages of high chiral purity.
Cook Phillip D. (San Marcos CA) Hoke Glenn (Mt. Airy MD), Oligonucleotides for modulating hepatitis C virus having phosphorothioate linkages of high chiral purity.
Cook Phillip D. (San Marcos CA) Hoke Glenn (Mt. Airy MD), Oligonucleotides for modulating protein kinase C having phosphorothioate linkages of high chiral purity.
Smith Lloyd M. (South Pasadena CA) Fung Steven (Palo Alto CA) Kaiser ; Jr. Robert J. (Glendale CA), Oligonucleotides possessing a primary amino group in the terminal nucleotide.
Lebleu Bernard (Montpellier FRX) Bayard Bernard (Castelnau Le Lez FRX), Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini.
Manolova, Vania; Bachmann, Martin F.; Cornelius, Andreas; Maurer, Patrik; Meijerink, Edwin; Proba, Karl G.; Schwarz, Katrin, Packaging of immunostimulatory oligonucleotides into virus-like particles: method of preparation and use.
Allerson, Charles; Bhat, Balkrishen; Swayze, Eric E.; Prakash, Thazha P., Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation.
Allerson, Charles; Bhat, Balkrishen; Swayze, Eric E.; Prakash, Thazha P., Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation.
Just George,CAX ; Xin Zhili ; Marsault Eric,CAX ; Jin Yi,CAX ; Wang Jianchao,CAX ; Manoharan Muthiah, Preparation of phosphorothioate and boranophosphate oligomers.
Cook Phillip Dan ; Sanghvi Yogesh S. ; Sprankle Kelly G. ; Ross Bruce S. ; Griffey Rich H. ; Springer Robert H., Process for the synthesis of 2'-O-substituted pyrimidines and oligomeric compounds therefrom.
Wojciech J. Stec PL; Lucyna A. Wozniak PL; Arkadiusz Chworos PL; Jaroslaw Pyzowski PL, Process for the synthesis of modified P-chiral nucleotide analogues.
Hawkins Mary E. (Potomac MD) Pfleiderer Wolfgang (Konstanz MD DEX) Davis Michael D. (Rockville MD) Balis Frank (Bethesda MD), Pteridine nucleotide analogs as fluorescent DNA probes.
Torrence Paul F. ; Silverman Robert Hugh ; Cirino Nick Mario ; Li Guiying ; Xiao Wei, RNase L activators and antisense oligonucleotides effective to treat RSV infections.
Torrence Paul F. ; Silverman Robert Hugh ; Cirino Nick Mario ; Li Guiying ; Xiao Wei ; Player Mark R., RNase L activators and antisense oligonucleotides effective to treat RSV infections.
Robert H. Silverman ; Seiji Kondo ; John K. Cowell ; Guiying Li ; Paul F. Torrence, RNase L activators and antisense oligonucleotides effective to treat telomerase-expressing malignancies.
Benson, Scott C.; Zou, Ruiming N.; Upadhya, Krishna G.; Kenney, Paul M.; Cassel, Jonathan M., Reagents useful for synthesizing rhodamine-labeled oligonucleotides.
Bennett, C. Frank; Hayden, Michael; Freier, Susan M.; Greenlee, Sarah; Carroll, Jeffrey; Warby, Simon; Swayze, Eric E., Selective reduction of allelic variants.
Stec Wojciech J. (Lodz PLX) Grajkowski Andrzej (Lodz PLX) Uznanski Bogdan (Lodz PLX), Solid phase oligonucleotide synthesis using phospholane intermediates.
Cook Phillip Dan (Carlsbad CA) Manoharan Muthiah (Carlsbad CA) Ramasamy Kanda S. (Laguna Hills CA), Substituted purines and oligonucleotide cross-linking.
※ AI-Helper는 부적절한 답변을 할 수 있습니다.