Two genes, ARID1A (AT-rich interactive domain-containing protein 1A) and PPP2R1A (protein-phosphatase 2, regulatory subunit 1, alpha), can be used in methods which are useful for detecting cancer, diagnosing cancer, contributing to a diagnosis of cancer, confirming a diagnosis of cancer, identifying
Two genes, ARID1A (AT-rich interactive domain-containing protein 1A) and PPP2R1A (protein-phosphatase 2, regulatory subunit 1, alpha), can be used in methods which are useful for detecting cancer, diagnosing cancer, contributing to a diagnosis of cancer, confirming a diagnosis of cancer, identifying appropriate treatments for cancer, monitoring treatment of cancer, and evaluating treatment protocols for cancer, including ovarian clear cell carcinoma, breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, and prostate cancer.
대표청구항▼
1. A method, comprising: amplifying coding regions of ARID1A gene or cDNA in a biological sample of an individual, wherein the biological sample comprises ovarian cells;sequencing the amplified coding regions of ARID1A gene or cDNA;detecting a mutation, wherein the mutation is a frameshift or a stop
1. A method, comprising: amplifying coding regions of ARID1A gene or cDNA in a biological sample of an individual, wherein the biological sample comprises ovarian cells;sequencing the amplified coding regions of ARID1A gene or cDNA;detecting a mutation, wherein the mutation is a frameshift or a stop codon in the gene or cDNA. 2. The method of claim 1, wherein the biological sample is selected from the group consisting of tissue, blood, serum, plasma, ascites, and urine. 3. The method of claim 1, wherein the individual is suspected of having ovarian cancer. 4. The method of claim 1, further comprising the step of obtaining the biological sample from the individual. 5. The method of claim 1, wherein the biological sample is obtained by a method selected from the group consisting of culdocentesis, paracentesis, and biopsy. 6. The method of claim 1 wherein the mutation is hemizgyous in the ovarian cells. 7. The method of claim 1 wherein the mutation is 3854_3855insA. 8. The method of claim 4, wherein the biological sample is obtained by a method selected from the group consisting of culdocentesis, paracentesis, and biopsy. 9. The method of claim 1, wherein the individual is suspected of having ovarian clear cell carcinoma (OCCC). 10. The method of claim 1, wherein the individual has endometriosis. 11. The method of claim 1, wherein the individual has abdominal swelling due to ascites. 12. The method of claim 1, wherein the mutation is a stop codon caused by a nonsense mutation. 13. The method of claim 1 wherein the mutation is a frameshift mutation caused by an insertion or a deletion. 14. The method of claim 1 wherein the mutation is selected from the group consisting of mutations: c.3854_3855insA; c.553C>T; c.903_904dupGT;c.3659_3684delTGATGGGGCGCATGTCCTATGAGCCA (SEQ ID NO:7), c.585C>A;c.3391delC; c.4001_4002dupGCA (hom); c.6828_6829delTG(hom); c.1455_1466insCCTAC;c.4926_4927insTGGC, c.4011_4012delTT (hom); c.4635G>A; c.5202T>A;486_492delCGCCGCC (hom); c.3575delA; 3223delG; 6718dupG; c.898_899insCGTC;c.6710_6711insT;1663C>T; c.782_791delCGTCGTCTTC (SEQ ID NO:8);c.3634_3644delCAGCCCAGTAT (SEQ ID NO:9); c.1873C>T; c.2122C>T; 1804G>T; c.6702delT; c.1341T>G; c.3442delC; c.883dupC; c.2868delC; c.1881delT; andc.2179_2188delCGGCCACCCA (SEQ ID NO:10) wherein the nucleotides are numbered by reference to SEQ ID NO: 2. 15. The method of claim 1 further comprising: amplifying mononucleotide repeats in nucleic acids of a biological sample of the individual;sizing the amplified mononucleotide repeats by electrophoresis. 16. A method, comprising: testing and detecting in a biological sample of an individual a shortened ARIDIA protein, wherein the biological sample comprises proteins of ovarian cells of the individual which are contacted with an antibody reactive with the N-terminus of the ARID1A protein;amplifying mononucleotide repeats in nucleic acids of a biological sample of the individual; andsizing the amplified mononucleotide repeats by electrophoresis. 17. The method of claim 15 wherein the mononucleotide repeats are in an ARID1A gene. 18. The method of claim 16 wherein the mononucleotide repeats are in an ARID1A gene. 19. A method comprising: amplifying mononucleotide repeats in an ARID1A gene in nucleic acids of a biological sample of an individual, wherein the biological sample comprises ovarian cells;sizing the amplified mononucleotide repeats by electrophoresis.
연구과제 타임라인
LOADING...
LOADING...
LOADING...
LOADING...
LOADING...
이 특허에 인용된 특허 (5)
David Gary S. (La Jolla CA) Greene Howard E. (Carlsbad CA), Immunometric assays using monoclonal antibodies.
Mullis Kary B. (La Jolla CA) Erlich Henry A. (Oakland CA) Arnheim Norman (Woodland Hills CA) Horn Glenn T. (Emeryville CA) Saiki Randall K. (Richmond CA) Scharf Stephen J. (Berkeley CA), Process for amplifying, detecting, and/or cloning nucleic acid sequences.
Mullis Kary B. (Kensington CA) Erlich Henry A. (Oakland CA) Arnheim Norman (Woodland Hills CA) Horn Glenn T. (Emeryville CA) Saiki Randall K. (Richmond CA) Scharf Stephen J. (Berkeley CA), Process for amplifying, detecting, and/or-cloning nucleic acid sequences.
※ AI-Helper는 부적절한 답변을 할 수 있습니다.