The present invention relates to new triphosphate-modified oligonucleotides which may act as RIG-I ligands as well as a new method allowing the synthesis and purification in high yield and purity suitable for pharmaceutical applications.
대표청구항▼
1. An oligonucleotide comprising a sense strand and an antisense strand, wherein the oligonucleotide comprises a sense strand comprising nucleotide sequence5′ GACGCUGfACCCUGAAmGUUCAUCPTOUfPTOU 3′ (SEQ ID NO: 72); andan antisense strand comprising nucleotide sequence3′ CUGmCGACUGGGACfUUCAAGUAGPTOAPTO
1. An oligonucleotide comprising a sense strand and an antisense strand, wherein the oligonucleotide comprises a sense strand comprising nucleotide sequence5′ GACGCUGfACCCUGAAmGUUCAUCPTOUfPTOU 3′ (SEQ ID NO: 72); andan antisense strand comprising nucleotide sequence3′ CUGmCGACUGGGACfUUCAAGUAGPTOAPTOA 5′ (SEQ ID NO: 73); ora sense strand comprising nucleotide sequence5′ GPTOAPTOCGCUGfACCCUGAAmGUUCAUCPTOUfPTOU 3′ (SEQ ID NO: 76); andan antisense strand comprising nucleotide sequence3′ CUGmCGACUGGGACfUUCAAGUAGPTOAPTOA 5′ (SEQ ID NO: 77);whereinthe nucleotide indexed m is 2′-O-methylated;the nucleotide indexed f is 2′-fluoro; andthe index PTO between two nucleotides indicates that said two nucleotides are linked by a phosphorothioate bond; andwherein the sense strand has a triphosphate at the 5′ end. 2. The oligonucleotide of claim 1, wherein the oligonucleotide is a RIG-I ligand. 3. A pharmaceutical composition comprising an oligonucleotide according to claim 1 and a pharmaceutically acceptable carrier, diluent and/or adjuvant. 4. The pharmaceutical composition of claim 3, wherein the pharmaceutically acceptable carrier, diluent and/or adjuvant is suitable for intraperitoneal, intramuscular, intravenous, intranasal, subcutaneous, intradermal or intrathecal administration. 5. The pharmaceutical composition of claim 4, wherein the pharmaceutically acceptable carrier, diluent and/or adjuvant is suitable for intradermal administration by tattooing, microneedling or microneedle patches. 6. A method for stimulating a patient's immune system, comprising administering an oligonucleotide comprising a sense strand and an antisense strand to a patient in need of such stimulation, wherein the sense strand comprises a nucleotide sequence of5′ GACGCUGACCCUGAAGUUCAUCUU 3′ (SEQ ID NO: 2); andthe antisense strand comprises a nucleotide sequence of3′ CUGCGACUGGGACUUCAAGUAGAA 5′(SEQ ID NO: 5); andthe oligonucleotide further comprises at least one triphosphate at one 5′ end of the oligonucleotide and at least one modification selected from the group consisting of 2′-O-methyl, 2′-fluoro and phosphorothioate bondwherein the modification is 2′-O-methyl and the sense strand and/or the antisense strand comprises at least one 2′-O-methylated ribonucleotide, wherein the nucleotide is nucleotide 3, 10, 13, 15, 16, 17, 20, or 23, or any combination thereof, of the sense strand, and/or the 2′-O-methylated ribonucleotide is the nucleotide at position 3, 18, 19, 21, 22 or 23, or any combination thereof, of the antisense strand; wherein the nucleotide position is counted from left to right for both the sense strand and antisense strand,and wherein the oligonucleotide further comprises at least one modification selected from 2′-fluoro and a phosphorothioate bond. 7. The method according to claim 6, wherein said oligonucleotide selectively stimulates the RIG-I signalling pathway. 8. The method according to claim 6, wherein said oligonucleotide is administered intraperitoneally, intramuscularly, intravenously, intranasally, subcutaneously, intradermally or intrathecally. 9. The method according to claim 8, wherein said modified oligonucleotide is administered intradermally by tattooing, microneedling or microneedle patches. 10. A pharmaceutical composition comprising an oligonucleotide according to claim 2 and a pharmaceutically acceptable carrier, diluent and/or adjuvant. 11. An oligonucleotide comprising a sense strand and an antisense strand, wherein the oligonucleotide comprises a sense strand comprising nucleotide sequence5′ GACGCUGfACCCUGAAmGUUCAUCPTOUfPTOU 3′ (SEQ ID NO: 72); andan antisense strand comprising nucleotide sequence3′ CUGmCGACUGGGACfUUCAAGUAGPTOAPTOA 5′ (SEQ ID NO: 73); orwhereinthe nucleotide indexed m is 2′-O-methylated;the nucleotide indexed f is 2′-fluoro; andthe index PTO between two nucleotides indicates that said two nucleotides are linked by a phosphorothioate bond; andwherein the sense strand has a triphosphate at the 5′ end. 12. An oligonucleotide consisting of a sense strand and an antisense strand, wherein the oligonucleotide consists of a sense strand consisting of nucleotide sequence5′ GACGCUGfACCCUGAAmGUUCAUCPTOUfPTOU 3′ (SEQ ID NO: 72); andan antisense strand consisting of nucleotide sequence3′ CUGmCGACUGGGACfUUCAAGUAGPTOAPTOA 5′ (SEQ ID NO: 73);whereinthe nucleotide indexed m is 2′-O-methylated;the nucleotide indexed f is 2′-fluoro; andthe index PTO between two nucleotides indicates that said two nucleotides are linked by a phosphorothioate bond; andwherein the sense strand has a triphosphate at the 5′ end. 13. A pharmaceutical composition comprising an oligonucleotide according to claim 12 and a pharmaceutically acceptable carrier or diluent. 14. A method for stimulating a patient's immune system, comprising administering an oligonucleotide according to claim 12 to a patient in need of such treatment. 15. A pharmaceutical composition comprising an oligonucleotide according to claim 12 and a pharmaceutically acceptable carrier and/or adjuvant. 16. A pharmaceutical composition comprising an oligonucleotide according to claim 12 and a pharmaceutically acceptable carrier, wherein said carrier comprises a sodium counterion. 17. A pharmaceutical composition comprising an oligonucleotide according to claim 12 and a sodium counterion.
연구과제 타임라인
LOADING...
LOADING...
LOADING...
LOADING...
LOADING...
이 특허에 인용된 특허 (34)
Ecker David J. (Carlsbad CA), Antisense inhibitors of the human immunodeficiency virus phosphorothioate oligonucleotides.
Wilfried Seifert, Compositions and methods for inhibiting cox-2 expression and treating cox-2 associated disorders by using cox-2 antisense oligonucleotides.
Agrawal Sudhir (Shrewsbury MA) Leiter Josef M. E. (Brooklyn NY) Palese Peter (Leonia NJ) Zamecnik Paul C. (Shrewsbury MA), Inhibition of influenza virus replication by oligonucleotide phosphorothioates.
Harel Bellan,Annick; Ait Si Ali,Slimane; Cabon Georget,Florence; Chauchereau,Anne; Dautry,Francois, Inhibitor oligonucleotides and their use for specific repression of a gene.
Cohen Jack S. (Bethesda MD) Neckers Len (Bethesda MD) Stein Cy (Gaithersburg MD) Loke She L. (Wheaton MD) Shinozuka Kazuo (Kazo JPX), Inhibitors for replication of retroviruses and for the expression of oncogene products.
Stec Wojciech J. (Lodz PLX) Grajkowski Andrzej (Lodz PLX) Uznanski Bogdan (Lodz PLX), Method of making oligonucleotides and oligonucleotide analogs using phospholanes and enantiomerically resolved phosphola.
Pederson Thoru (Worcester MA) Agrawal Sudhir (Shrewsbury MA) Mayrand Sandra (Shrewsbury MA) Zamecnik Paul C. (Shrewsbury MA), Method of site-specific alteration of RNA and production of encoded polypeptides.
Pederson Thoru (Worcester MA) Agrawal Sudhir (Shrewsbury MA) Mayrand Sandra (Shrewsbury MA) Zamecnik Paul C. (Shrewsbury MA), Method of site-specific alteration of RNA and production of encoded polypeptides.
Stec Wojciech J. (Lodz PLX) Uznanski Bogdan (Lodz CA PLX) Bergot B. John (Redwood City CA) Hirschbein Bernard L. (San Francisco CA) Fearson Karen L. (Union City CA), Method of synthesizing sulfurized oligonucleotide analogs.
Cook, Phillip D.; Wang, Guangyi; Bruice, Thomas W.; Boyle, Nicholas A.; Leeds, Janet M.; Brooks, Jennifer L.; Prhavc, Marija; Ariza, Maria Eugenia; Fagan, Patrick C.; Jin, Yi; Rajwanshi, Vivek K.; Tucker, Kathleen D., Nucleotide mimics and their prodrugs.
Cook, Phillip D.; Wang, Guangyi; Bruice, Thomas W.; Boyle, Nicholas A.; Leeds, Janet M.; Brooks, Jennifer L.; Prhavc, Marija; Ariza, Maria Eugenia; Fagan, Patrick C.; Jin, Yi; Rajwanshi, Vivek K.; Tucker, Kathleen D., Nucleotide mimics and their prodrugs.
Eppstein Deborah A. (Los Altos CA) Fraser-Smith Elizabeth B. (Los Altos CA) Matthews Thomas R. (Los Gatos CA), Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides.
※ AI-Helper는 부적절한 답변을 할 수 있습니다.