The chum salmon (Oncorhynchus keta) is an anadromous fish distributed all around the North Pacific. Artificial production and release of the juveniles are being made by Korea, Japan, Russia, Canada and the United States. It is important to set up some criteria identifying each stock in order to clar...
The chum salmon (Oncorhynchus keta) is an anadromous fish distributed all around the North Pacific. Artificial production and release of the juveniles are being made by Korea, Japan, Russia, Canada and the United States. It is important to set up some criteria identifying each stock in order to clarify each nation's right of harvest for the chum salmon resource. As an attempt to build such criteria, we analyzed sequences of a microsatellite DNA Ogo5 and the COIII-ND3-ND4L region of the mitochondrial DNA from chum salmons of Korea, Japan, and the United States. Ogo5 has 4 different alleles: allele A, B-1, B-2, and B-3. Allele B-3 is found only in 3 individuals out of 12 Korea salmons. The Japan salmons have the other 3 alleles and the America salmons have only 2 allots, A and B-1. Heterozygosity index (Ho/He) distinguishes the Korea (1.61) and Japan salmons (1.63) from the America ones (1.09). Seventeen different haplotypes are found in the COIII-ND3-ND4L region from 60 individuals,20 from each stock. The gene genealogy of the haplotypes revealed by TCS program shows that the Korea and Japan salmons are genetically closely linked, but that they are clearly distinguished from the America ones. Ten and eleven individuals of the Korea and Japan salmons have an identical haplotype. Nine individuals of the Korea salmons $(45\%),$ however, are separable from the Japan salmons by their own specific nucleotides. This result presents usefulness of the COIII-ND3-ND4L region as a genetic marker for identification of the chum salmon stocks.
The chum salmon (Oncorhynchus keta) is an anadromous fish distributed all around the North Pacific. Artificial production and release of the juveniles are being made by Korea, Japan, Russia, Canada and the United States. It is important to set up some criteria identifying each stock in order to clarify each nation's right of harvest for the chum salmon resource. As an attempt to build such criteria, we analyzed sequences of a microsatellite DNA Ogo5 and the COIII-ND3-ND4L region of the mitochondrial DNA from chum salmons of Korea, Japan, and the United States. Ogo5 has 4 different alleles: allele A, B-1, B-2, and B-3. Allele B-3 is found only in 3 individuals out of 12 Korea salmons. The Japan salmons have the other 3 alleles and the America salmons have only 2 allots, A and B-1. Heterozygosity index (Ho/He) distinguishes the Korea (1.61) and Japan salmons (1.63) from the America ones (1.09). Seventeen different haplotypes are found in the COIII-ND3-ND4L region from 60 individuals,20 from each stock. The gene genealogy of the haplotypes revealed by TCS program shows that the Korea and Japan salmons are genetically closely linked, but that they are clearly distinguished from the America ones. Ten and eleven individuals of the Korea and Japan salmons have an identical haplotype. Nine individuals of the Korea salmons $(45\%),$ however, are separable from the Japan salmons by their own specific nucleotides. This result presents usefulness of the COIII-ND3-ND4L region as a genetic marker for identification of the chum salmon stocks.
* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.
문제 정의
(1980)은 동위효소의 변이에 근거하여 연어를 아시아 계군 (일본, 러시아), 알래스카 계군, 북미 계군으로 구분하였다. 본 연구 결과는 한국 연어가 지리 적으로 가까운 일본 연어와 함께 아시아 계군에 속할 가능성을 제시해 준다.
본 연구는 한국, 일본, 미국에서 방류되는 연어집단의 유전적 차이 유무를 밝히고, 이를 구분하는 표지를 확립할 목적으로 수행되었다. 이를 위하여 연어와 진화적으로 가까운 곱사연어 (Domanico and Phillips, 1995)에서 알려진 마이크로새틀라이 트 DNA Ogo5 (Olsen et al.
제안 방법
예상하는 크기로 증폭된 DNA는 QIAquick PCR purification kit (Qiagen)를 이용하여 정제하고, Dye-terminator와 T7 (TAATACGACTCACTATA GGG) 혹은 Sp6 (ATTTAGGTCACACTATAG) 프라이머를 사용하여 염기 배열 결정 PCR 반응을 진행시켰다. COⅢ-ND3-ND4L의 PCR 반응은 처음 이 유전자를 증폭하기 위해 사용하였던 COⅢ와 ND4L 프라이머를 사용하여 실시하였다. 이후 PCR 반응산물 인 DNA/를 알콜침전법으로 정제하고, Automated DNA sequencer 377 (Applied Biosystems)로 전기영동하여 염기배열 을 결정하였다.
한국 연어 20개체, 일본 연어 20개체, 미국 연어 20개체에서 미토콘드리아 COIH-ND3-ND4L 유전자의 염기배열을 분석하였다. Domanico and Phillips (1995)가 이용한 COⅢ와 ND4L 프라이머를 사용하여 PCR을 진행시켜 약 780bp 크기의 DNA 단편을 선택적으로 증폭하였다 (Fig. 3). 이 PCR 산물을 정제 하고 바로 염 기배 열을 결정하여 프라이 머를 제외한 744 bp의 염기배열을 모든 개체에서 확인하였다 (Fig.
PCR 반응기로서 GeneAmp PCR System 2400 (Perkin Elmer) 또는 TGradient Thermocycler (Whatman, Biometra)를 사용하였다. PCR이 끝난 후 반응용액 8“L를 0.8% 아가로스 젤에 전기영동 하여 증폭된 DNA의 크기를 확인하였다.
PCR 산물이 들어가 흰색이나 옅은 청색으로 자라는 콜로니를 선택 흐!■여 M13F (TGTAAAACGACGGCCAGT)와 M13R (CAGGAAACAGCTATGACCATG) 프라이머를 사용하여 삽입된 DNA를 PCR로 증폭하였다. PC®] 끝난 후 반응용액 8“L를 0.8% 아가로스 젤에 전기영동하여 예상하는 크기의 DNA가 증폭되었는지를 판단하였다. 예상하는 크기로 증폭된 DNA는 QIAquick PCR purification kit (Qiagen)를 이용하여 정제하고, Dye-terminator와 T7 (TAATACGACTCACTATA GGG) 혹은 Sp6 (ATTTAGGTCACACTATAG) 프라이머를 사용하여 염기 배열 결정 PCR 반응을 진행시켰다.
coll 내로 이전시켰다. PCR 산물이 들어가 흰색이나 옅은 청색으로 자라는 콜로니를 선택 흐!■여 M13F (TGTAAAACGACGGCCAGT)와 M13R (CAGGAAACAGCTATGACCATG) 프라이머를 사용하여 삽입된 DNA를 PCR로 증폭하였다. PC®] 끝난 후 반응용액 8“L를 0.
시료 에서 약 70 mg을 떼어내 DNA 분리 kit가 제시하는 방법에 따라 실험을 진행시켜 게놈 DNA를 분리하였다. 분리된 게놈 DNA는 0.8% 아가로스 젤에 전기영동하여 추출된 상태를 확 인하였으며, 260nni에서 흡광도를 측정하여 그 농도를 결정하였다.
냉동된 간 시료는 바로 DNA 분리에 사용하였고, 에탄올에 고정된 시료 는 사용 전 3차 증류수로 여러 차례 씻은 후 사용하였다. 시료 에서 약 70 mg을 떼어내 DNA 분리 kit가 제시하는 방법에 따라 실험을 진행시켜 게놈 DNA를 분리하였다. 분리된 게놈 DNA는 0.
8% 아가로스 젤에 전기영동하여 예상하는 크기의 DNA가 증폭되었는지를 판단하였다. 예상하는 크기로 증폭된 DNA는 QIAquick PCR purification kit (Qiagen)를 이용하여 정제하고, Dye-terminator와 T7 (TAATACGACTCACTATA GGG) 혹은 Sp6 (ATTTAGGTCACACTATAG) 프라이머를 사용하여 염기 배열 결정 PCR 반응을 진행시켰다. COⅢ-ND3-ND4L의 PCR 반응은 처음 이 유전자를 증폭하기 위해 사용하였던 COⅢ와 ND4L 프라이머를 사용하여 실시하였다.
3). 이 PCR 산물을 정제 하고 바로 염 기배 열을 결정하여 프라이 머를 제외한 744 bp의 염기배열을 모든 개체에서 확인하였다 (Fig. 4). 첫 번째 염기 에서 273번째까지는 COI1I 유전자의 3, 쪽 말단이고, 274-624 염기배열은 ND3 유전자이며, 625-744 염기배열은 ND4L 유전 자의 5, 쪽 단편이다.
본 연구는 한국, 일본, 미국에서 방류되는 연어집단의 유전적 차이 유무를 밝히고, 이를 구분하는 표지를 확립할 목적으로 수행되었다. 이를 위하여 연어와 진화적으로 가까운 곱사연어 (Domanico and Phillips, 1995)에서 알려진 마이크로새틀라이 트 DNA Ogo5 (Olsen et al., 1998)와 미토콘드리아 유전자 중 변화율이 특히 높은 것으로 알려진 ND3 (Jacobs et al., 1988; Sunnucks, 2000)와 그 주변 지역 COⅢ와 ND4L 말단의 염기배열을 분석하여 한국, 일본, 미국의 연어 시료간 서로 비교하였다.
COⅢ-ND3-ND4L의 PCR 반응은 처음 이 유전자를 증폭하기 위해 사용하였던 COⅢ와 ND4L 프라이머를 사용하여 실시하였다. 이후 PCR 반응산물 인 DNA/를 알콜침전법으로 정제하고, Automated DNA sequencer 377 (Applied Biosystems)로 전기영동하여 염기배열 을 결정하였다. 결정 된 염 기배 열은 MacVector 프로그램 내의 Clustal W (version 6.
추출된 게놈 DNA을 사용하여 마이크로새틀라이트 DNA Ogo5를 중합효소연쇄반응 (PCR)으로 선택적으로 증폭하였다. Ogo5 증폭에 사용된 프라이머는 Olsen et al.
PCR로 증폭된 DNA는 대립유전자가 2개 이상인 Ogo5의 경우 TOPO TA cloning kit (Invitrogen)를 사용하여 클로닝하였 고, 대립유전자가 1개인 COⅢ-ND3-ND4L의 경우 PCR 산물 을 정제하여 바로 염기배열을 결정하였다. 클로닝 과정은 제 품에서 제시한 실험과정을 따라 진행하였으며, PCR 산물을 pCRII-TOPO vector에 연결하고 E. coll 내로 이전시켰다. PCR 산물이 들어가 흰색이나 옅은 청색으로 자라는 콜로니를 선택 흐!■여 M13F (TGTAAAACGACGGCCAGT)와 M13R (CAGGAAACAGCTATGACCATG) 프라이머를 사용하여 삽입된 DNA를 PCR로 증폭하였다.
한국 연어 20개체, 일본 연어 20개체, 미국 연어 20개체에서 미토콘드리아 COIH-ND3-ND4L 유전자의 염기배열을 분석하였다. Domanico and Phillips (1995)가 이용한 COⅢ와 ND4L 프라이머를 사용하여 PCR을 진행시켜 약 780bp 크기의 DNA 단편을 선택적으로 증폭하였다 (Fig.
대상 데이터
추출된 게놈 DNA을 사용하여 마이크로새틀라이트 DNA Ogo5를 중합효소연쇄반응 (PCR)으로 선택적으로 증폭하였다. Ogo5 증폭에 사용된 프라이머는 Olsen et al. (1998)이 곱사 연어에서 밝힌 것을 그대로 사용하였다 (Ogo5F:GGTTTGAC- ATTTAAGGCGGA, Ogo5R:GGGTGTTCAAGCTCACTGCT).
PCR 반응과정과 시간, 온도 조건은 다음과 같다: 초기 활성화 (95℃, 15분); 35회 반복 과정의 denaturation (95℃, 1 분), annealing (50℃, 1 분), extension (72℃, 1분); 최후 반응 (72℃, 10분); 보관 (4℃). PCR 반응기로서 GeneAmp PCR System 2400 (Perkin Elmer) 또는 TGradient Thermocycler (Whatman, Biometra)를 사용하였다. PCR이 끝난 후 반응용액 8“L를 0.
연어의 게놈 DNA를 분리하기 위해 Blood and Cell culture DNA Midi Kit (Qiagen, Germany)를 사용하였다. 냉동된 간 시료는 바로 DNA 분리에 사용하였고, 에탄올에 고정된 시료 는 사용 전 3차 증류수로 여러 차례 씻은 후 사용하였다. 시료 에서 약 70 mg을 떼어내 DNA 분리 kit가 제시하는 방법에 따라 실험을 진행시켜 게놈 DNA를 분리하였다.
연어의 게놈 DNA를 분리하기 위해 Blood and Cell culture DNA Midi Kit (Qiagen, Germany)를 사용하였다. 냉동된 간 시료는 바로 DNA 분리에 사용하였고, 에탄올에 고정된 시료 는 사용 전 3차 증류수로 여러 차례 씻은 후 사용하였다.
이들 지역은 각 나라에서 연어의 회유량이 비교적 많은 대표적인 연어 산지이다. 연어의 유전 자 분석에 간 (liver) 조직을 이용하였다. 간 조직은 채취 후 100% 에탄올에 고정하거나 냉동 보관하여 실험실로 운반하였다.
유콘강 계군, 남동 알래스카.캐나다 British Columbia 계군으로 구분하였다. Utter et al.
한국 연어는 동해안에 위치한 양양의 남대천에서, 일본 연 어는 홋카이도 서쪽 연안에 위치한 Mashike의 Shokanbetsu 강에서, 미국 연어는 북태평양 동안에 위치한 워싱턴주 소재 Quilcene에서 채집하였다. 이들 지역은 각 나라에서 연어의 회유량이 비교적 많은 대표적인 연어 산지이다.
데이터처리
이후 PCR 반응산물 인 DNA/를 알콜침전법으로 정제하고, Automated DNA sequencer 377 (Applied Biosystems)로 전기영동하여 염기배열 을 결정하였다. 결정 된 염 기배 열은 MacVector 프로그램 내의 Clustal W (version 6.5.3, Oxford Molecular)를 사용하여 개체간 서로 비교하였다. 염기배열의 차이에 근거하여 개체간, 집단 간의 유전적 관계를 TCS 프로그램 (ver.
3, Oxford Molecular)를 사용하여 개체간 서로 비교하였다. 염기배열의 차이에 근거하여 개체간, 집단 간의 유전적 관계를 TCS 프로그램 (ver. 1.13; Clement et al., 2000)을 이용하여 분석하였다.
성능/효과
반면, 한국과 일본, 미국 연어에서 동일한 염기배열을 갖는 개체는 각각 1개처〕, 3개체, 3개체에 불과 하였다 (전체의 5-15%). 한국과 일본 연어 사이에 유전적 유사 성이 높은 것은 1) 두 계군이 분리된 시기가 지금부터 그다지 오래되지 않아 변이가 축적될 시간이 충분치 않았을 가능성, 2) 두 나라 연어 사이에 지금도 지속적인 개체의 이동 (migration)이 일어나고 있을 가능성, 3) 1985-1986년에 일본으 로부터 100만 마리 이상의 인공종묘 (발아난)를 도입하여 양양 남대천에 방류함으로써 인위적인 유전자 교환이 일어났을 가능성 등으로 설명될 수 있다. 한편, 한국과 일본, 미국 연어의 5-15%가 동일한 haplotype을 갖는 것은 두 계군 사이의 유전자 교환이 매우 적음을 시사한다.
COⅢ-ND3-ND4L 염기배열은 분석한 연어 60개체에서 전체 염기가 삽입이나 결실이 없이 잘 보존되었다. 단일염기 다형성 (SNP, single nucleotide polymorphism)은 모두 20개의 위치에서 발견되었으며, SNP에 의해 서로 다른 염기배열을 갖는 haplotype이 17 종류가 구분되었다.
단일염기 다형성 (SNP, single nucleotide polymorphism)은 모두 20개의 위치에서 발견되었으며, SNP에 의해 서로 다른 염기배열을 갖는 haplotype이 17 종류가 구분되었다. 단일염 기 다형성이 발견된 20개의 위치 중 13개가 한 개체에서만 발견되는 개체 특이적 변이 (singleton)였고, 7개는 두 개체 이상에서 공통적 으로 발견되는 집단 특이적 염기변이였다 (Fig. 5). 한국 연어 는 246번째 염기가 두 개체에서 아데닌 (A)이었고, 307번째 염기가 다섯 개체에서 시토신 (C)이었다.
COⅢ-ND3-ND4L 염기배열은 분석한 연어 60개체에서 전체 염기가 삽입이나 결실이 없이 잘 보존되었다. 단일염기 다형성 (SNP, single nucleotide polymorphism)은 모두 20개의 위치에서 발견되었으며, SNP에 의해 서로 다른 염기배열을 갖는 haplotype이 17 종류가 구분되었다. 단일염 기 다형성이 발견된 20개의 위치 중 13개가 한 개체에서만 발견되는 개체 특이적 변이 (singleton)였고, 7개는 두 개체 이상에서 공통적 으로 발견되는 집단 특이적 염기변이였다 (Fig.
본 연구에서 밝혀진 연어 의 계군 구조를 이 가설에 대비해 보면, 한국과 일본 연어는 오호츠크해 피한지 연어의 후손이며 미국 연어는 Cascadia 피한지 연어의 후손으로 추론할 수 있다. 본 연구에서 coin- ND3-ND4L의 염기배열은 연어 집단 간의 유전적 상관관계를 보여줄 뿐만 아니라, 각 계군과 haplotype을 구분할 수 있는 명백한 기준 (독특한 DNA 염기배열 형질)을 제시하는 좋은 유전자 마커 (genetic marker)임이 드러났다. 비록, 한국 연어가 일본 연어와 유전적으로 유사하고 같은 계군에 속한다고 하더 라도 조사된 약 45% 개체가 독특한 COⅢ-ND3-ND4L 염기배 열을 갖고 있으므로, 이 유전자는 한국의 독특한 개체군을 일본 연어와 구분할 수 있는 표지로서 매우 유용하다.
나머지 세 개체 역시 주요 haplotype에서 한 두 개의 개체 특이적 변이 (singleton)만을 갖는 독립된 염기배열을 보인다. 본 연구에서 분석된 결과로만 볼 때, 미국 연어는 유전적 구성이 비교적 단순하다고 볼 수 있다.
연어의 COⅢ-ND3-ND4L 염기배열을 이용하여 TCS 분석 (Clement et al., 2000)을 실시한 결과 한국 연어는 유전적 형 질 이 일본 연어와 유사하며, 이들은 미국 연어와 뚜렷이 구분되 었다 (Fig. 6). 즉, 한국, 일본, 미국의 연어가 COⅢ-ND3-ND4L 유전 형질에 따라 한국과 일본 계군, 미국 계군으로 구분됨을 보여준다.
연어의 간 조직에서 추출된 게놈 DNA를 이용하여 마이크 로새틀라이트 DNA를 PCR 반응으로 증폭한 결과, Ogo5 프라이머에 의해 약 200 bp의 DNA가 증폭되었다 (Fig. 1). Ogo5는 한국 연어 12개체, 일본 연어 8개체, 미국 연어 10개체에서 모두 4개의 대립유전자 염기배열이 나타났다: allele A, 183 bp; allele 日니 , 180 bp; allele B-2, 182 bp; allele B-3, 183 bp (Fig.
6). 즉, 한국, 일본, 미국의 연어가 COⅢ-ND3-ND4L 유전 형질에 따라 한국과 일본 계군, 미국 계군으로 구분됨을 보여준다. 한국과 일본 연어는 50% 이상 (한국 연어 10개체, 일본 연어 11개체)이 동일한 염기배열을 갖으며 같은 haplotype에 속하였다.
미국 연어는 57번째, 534번째, 591번째 염기가 조사한 20 개체 모두에서 시토신 (C), 구아닌 (G), 구아닌 (G)이었으나 한국과 일본 연어는 이 세 위치에서 각각 3-6개체만 미국 연어와 동일한 염기를 갖고 나머지 개체는 티민 (T), 아데닌 (A), 아데 닌 (A)을 갖고 있었다. 특히, 미국 연어는 20 개체 중 17 개체가 303번째 염기로 티민 (T; 나머지 세 개체는 시토신, C)을 갖고 있어 조사한 모든 개체가 시토신 (C)을 갖고 있는 한국과 일본 연어와 분명히 구분되었다. 이와 같은 COⅢ-ND3- ND4L의 단일염기 다형성 패턴은 한국과 일본 연어가 유전적으로 가까 운 집단이며, 미국 연어는 상대적으로 먼 유전적 집단임을 시사한다.
참고문헌 (30)
Allendorf, F.W. and L.W. Seeb. 2000. Concordance of genetic divergence among sockeye salmon populations at allozyme, nuclear DNA, and mitochondrial DNA markers. Evolution, 54, 640-651
Avise, J.C. 1994. Molecular Markers, Natural History and Evolution. New York
Beacham, T.D., S. Pollard and K.D. Le. 2000. Microsatellite DNA population structure and stock identification of steelhead trout (Oncorhynchus mykiss) in the Nass and Skeena rivers in northern British Columbia. Mar. Biotechnol., 2, 587-600
Choi, Y.S. 2002. Cloning and nucleotide sequence of mitochondrial NADH dehydrogenase subunit 3 DNA for population analysis of chum salmon,Oncorhynchus keta. Master's thesis, Gangnung Univ. (in Korean)
Choi, Y.S., Y.H. Lee and D.H. Jin. 2003. Cloning and DNA sequences analysis of mitochondrial NADH dehydrogenase subunit 3 from Korean chum salmon, Oncorhynchus keta. J. Kor. Fish. Soc. (in press)
Clement, M., D. Posada and C.A. Crandall. 2000. TCS: a computer program to estimate gene genealogies. Mol. Ecol., 9, 1657-1660
Cornuet, J.M. and G. Luikart. 1996. Description and power analysis of two tests for detecting recent population bottlenecks from allele frequency data. Genetics, 144, 2001-2014
Domanico, M.J. and R.B. Phillips. 1995. Phylogenetic analysis of Pacific salmon (Genus Oncorhynchus) based on mitochondrial DNA sequence data. Mol. Phylogenet. Evol., 4, 366-371
Domanico, M.J., R.B. Phillips and T.H. Oakley. 1997. Phylogenetic analysis of Pacific salmon (genus Oncorhynchus) using nuclear and mitochondrial DNA sequences. Can. J. Fish. Aquat. Sci, 54, 1865-1872
Hong K..P., J.G. Myoung, J.K. Son and C.W. Park. 1994. A biochemical study for the development of genetic marker on salmonids in Korea. Bull. K-or. Fish. Soc.,27, 83-88
Jacobs, H.T., D.J. Elliott, V.B. Math and A. Farquharson. 1988. Nucleotide sequence and gene organization of sea urchin mitochondrial DNA. J. Mol. Biol., 202, 185-217
Jarne, P. and J.L. Lagoda. 1996. TREE., 11, 424-429
Jung, W.S., Y.H. Lee, H.C. Shin, K.B. Seong and S.A. Kim. 2001. Species identification of the chum salmon (Oncorhynchus keta) and pink salmon (0. gorbuscha) by use of genetic markers. J. Kor. Soc. Fish. Res., 4, 30-41. (in Korean)
Kitano, T., N. Matsuoka and N. Saitou. 1997. Phylogenetic relationship of the genus Oncorhynchus species inferred from nuclear and mitochondrial markers. Genes Genetic Syst., 72, 25-34
Lee, H.J., J.Y. Park, J.H. Lee, K.S. Min, I.G. Jeon, M.A. Yoo and W.H. Lee. 2000. Phylogeny of the subfamily Salmonidae distributed in Korea based upon nu cleotide sequences of mitochondrial ribosomal RNA genes. J. Kor. Fish. Soc., 33, 103-109
McConnell, S., L. Hamilton, D. Morris, D. Cook, D. Paquet, P. Bentzen and J. Wright. 1995. Isolation of salmonid microsatellite loci and their application to the population genetics of Canadian east coast stocks of Atlantic salmon. Aquaculture, 137, 19-30
McKay, S.J., R.H. Devlin and M.J. Smith. 1996. Phylogeny of Pacific salmon and trout based on growth hormone type-2 and mitochondrial NADH dehydrogenase subunit 3 DNA sequences. Can. J. Fish. Aquat. Sci., 53, 1165-1176
McPhail, J.D. and C.C. Lindsey. 1970. Freshwater fishes of northwestern Canada and Alaska. Bull. Fish. Res. Board Can., 173, 381
McPhail, J.D. and C.C. Lindsey. 1986. Zoogeography of the freshwater fishes of Cascadia (the Columbia system and rivers north to the Stikine). In: Zoo-geography of North American Freshwater Fishes, Hocutt, C.H. and E.O. Wiley, ed. Wiley and Sons, New York, N.Y., PP. 615-637
Myoung, J.G. and C.W. Park. 1992. Morphological and taxonomic studies of Oncorhynchus sp. in Korea. Korea Ocean Research and Development Institute. BSPE 00254-420-3. (in Korean)
Nei, M., T. Maruyama and R. Chakraborty. 1975. The bottleneck effect and genetic variability in populations. Evolution, 29, 1-10
Nelson, R.J., T.D. Beacham and M.P. Small. 1998. Microsatellite analysis of the population structure of a Vancouver Island sockeye salmon (Oncorhynchus nerkd) stock complex using nondenaturing gel electrophoresis. Mol. Mar. Biol. Biotechnol., 7, 312-319
O'Connell, M., D.O.F. Skibinski and J.A. Beardmore. 1996. Allozyme and mtDNA divergence between Atlantic salmon populations in North Wales. J. Fish Biol., 48, 1023-1026
Seong, K.B. 1999. Biological characteristics and population genetics of salmonid species from Korea. Ph. D. Thesis, Pukyong Nat'l Univ., PP. 125. (in Korean)
Sunnucks, P. 2000. Efficient genetic markers for population biology. TREE., 15, 199-203
Taylor, E.B., T.D. Beacham and M. Kaeriyama. 1994. Population structure and identification of north Pacific ocean chum salmon (Oncorhynchus keta) revealed by an analysis of minisatellite DNA variation. Can. J. Fish. Aquat, Sci, 51, 1430-1442
Utter, F.M., S.G. Campton, G. Miller, J. Seeb and L. Wishard. 1980. Population structure of indigenous salmonid species of the Pacific Northwest. In: Salmonid ecosystems of the North Pacific, McNeil, W.J. and D.C. Himsworth, ed. Oregon State Univ. Press, PP. 285-304
Wright, J.M. and P. Bentzen. 1994. Microsatellites: genetic markers for the future. Fish Biol. Fish., 4, 384-388
※ AI-Helper는 부적절한 답변을 할 수 있습니다.