[논문]Antiallergic and Antipsoriatic Effects of Korean Red Ginseng

Bae, Eun-Ah; Han, Myung-Joo; Shin, Yong-Wook; Kim, Dong-Hyun

doi:10.5142/jgr.2005.29.2.080

Antiallergic and Antipsoriatic Effects of Korean Red Ginseng 원문보기

Journal of ginseng research = 高麗人參學會誌, v.29 no.2 = no.78, 2005년, pp.80 - 85

Bae, Eun-Ah (Department of Food and Nutrition, Kyung Hee University) , Han, Myung-Joo (Department of Food and Nutrition, Kyung Hee University) , Shin, Yong-Wook (Department of College of Pharmacy, Kyung Hee University) , Kim, Dong-Hyun (Department of College of Pharmacy, Kyung Hee University)

Abstract ▼ AI-Helper

Antiallergic and antipsoriatic effects of korean Red Ginseng (KRG, steamed root of panax ginseng C.A. Meyer, Family Araliaceae) were measured. Orally administered KRG water extract potently inhibited passive cutaneous anaphylaxis (PCA). KRG water extract also showed the potent inhibition in oxazolone-induced mouse dermatitis, and suppressed mouse ear swelling by $39\%$ at 16 days at a dose of $0.1\%$. KRG water extract reduced the levels of mRNA of cyclooxygenase (COX)-2, $IL-1\beta$, $TNF-\alpha$ and $INF-\gamma$ increased in oxazolone-applied mouse ears, however, did not inhibit that of IL-4. KRG water extract also inhibited iNOS and COX-2 mRNA expression level of RAW264.7 cell induced by lipopolysaccharide. Based on these findings, we suggest that KRG can improve atopic and contact dermatitis by the regulation of $ IL-1\beta$ and $TNF-\alpha$ produced by macrophage cells and $interferon-\gamma$ produced by Th1 cells.

주제어

AI 본문요약
AI-Helper

* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.

제안 방법

PCA reaction in mice was induced by the intradermal injection of anti-DNP-HSA and KRG water extract was administered orally 60 min prior to challenge with DNP- HSA antigen and their inhibitory potency of PCA reaction was measured (Table 1). KRG water extract potently inhibited PCA reaction, and at doses of 100 and 500 mg/ kg inhibited PCA reaction by 62 and 90%, respectively.
The concentration of RNA content was determined by measuring the absorbance at 260 and 280 nm and stored at -70℃ until RT-PCR analysis. The RT-PCR was performed with AccPower® RT/PCR Premix (Bioneer, Seoul, Korea). The primers were designed as described by UniSTS database: COX-1, forward primer 5, -CTTTTATC- CTCCCAGGATTTGG-3 and reverse primer 5 _七GCTAA- ATACTTTGACACCGG-3' (product size 231 bp); COX-2 (UniSTS 254306), forward primer EGTATCCCCCCA- CAGTCAAAGACAC-3 and reverse primer 5'-GTGCTC- CCGAAGCCAGATGG-35 (product size 146 bp); IL-Ip forward primer 5'-ATGGCAACTGTCCCTGAACT・3 and reverse primer 5 _七GTCGTTGCTTGTCTCTCCTT3 (product size 508 bp); IFN-y (UniSTS 160031), forward primer 51 -CTTTAACAGCAGGCCAGACA-35 and reverse primer 55 -GCGAGTTATTTGTCATTCGG-3: (product size 144 bp); IL-4 (UniSTS 143568), forward primer 5'・CCGAT- TATGGTGTAATTTCCTATGCTG3 and reverse primer 5'GGCCAATCAGCACCTCTCTTCCAG-3' (product size 111 bp); tumor necrosis factor (TNF)-a (UniSTS 209165), forward primer 5'-GATTTTATTTGTTTAAAA- GCAGATATC-35 and reverse primer 5, -CATCCTAAG- TCTACACAGGATCT-3, (product size 206bp); GAPDH (UniSTS 225899), forward primer 5'-ACCACAGTC・ CATGCCATCAC・3' and reverse primer 5'-TCCACCAC・ CCTGTTGCTGTA-3' (product size 452 bp).

데이터처리

All the data were expressed as the mean ± S.E., and sta- tisticalsignificance was analyzed by one way ANOVA followed by Student-Newman-Keuls test.

이론/모형

The lysed nuclei fraction was centrifuged at 12000xg and 4℃ for 30 min. Protein expression levels of COX-2, iNOS, NF-kB and p-actin of the cell lysates (40 (ig) were analyzed by the above immunoblot method.

참고문헌 (24)

Shibata, S., Fujita, M., Itokawa, H., Tanaka, O. and Ishii, T. : Panaxadiol, a sapongenin of ginseng roots (1). Chem. Pharm. Bull., 11, 759-764 (1963)

상세보기
Tanaka, N., Tanaka, O. and Shibata, S. : Chemical studies on the oriental plant drugs. XXVIII. Saponins and sapogenins of ginseng; Stereochemistry of sapogenin of ginsenoside Rb1, Rb2 and Rc. Chem. Pharm. Bull., 20,1212-1216 (1972)

상세보기
Kitagawa, I., Yoshikawa, M., Yoshihara, M., Hayashi, T. and Taniyama, T. : Chemical studies on crude drug precession. I. On the constituents of ginseng radix rubura (I). Yakugaku Zasshi 103, 612-622 (1983)
Kown, S.W., Han, S.B., Park, I.H., Kim, J.M., Park, M.K., and Park, J.H.: Liquid chromatographic determination of less polar ginsenosides in processed ginseng. J. Chromatogr. A, 921, 335-339 (2001)

상세보기
Kim, W.Y., Kim, J.M., Han, S.B., Lee, S.K., Kim, N.D., Park, M.K., Kim, C.K. and Park, J.H. : Steaming of ginseng at high temperature enhances biological activity. J. Nat. Prod. 63, 1702-1704 (2000)

상세보기
Wu, J.Y., Gardner, B.H., Murphy, C.l., Seals, J.R., Kensil, C.R., Recchia, J. and Beltz, G.A. : Newman, G.W. and Newman, M.J., Saponin adjuvant enhancement of antigen-specific immune responses to an experimental HIV-1 vaccine. J. Immunol., 148, 1519-1525 (1992)
Bae, E.A., Han, M,J., Choo, M.K., Park, S.Y. and Kim, D.H. : Metabolism of 20(S)- and 20(R)-ginsenoside Rg3 by human intestinal bacteria and its relation to in vitro biological activities. Biol. Pharm. Bull., 25, 58-63 (2002)

상세보기
Kim, N.D., Kang, S.Y., Kim, M.J. and Park, J.H.: SchiniKerth, V.B., The ginsenoside Rg3 evokes endothelium-independent relaxation in rat aortic rings: role of K+ channels. Eur J Pharmacol. 367, 51-57 (1999)

상세보기
Wakabayashi, C., Hasegawa, H., Murata, J. and Saiki, I.: In viva antimetastatic action of ginseng protopanaxadiol saponins is based on their intestinal bacterial metabolites after oral administration. Oncol. Res., 9, 411-417 (1998)
Tachikawa, E., Kudo, K., Harada, K., Kashimoto, T., Miyate, Y., Kakizaki, A. and Takahashi, E., Effects of ginseng saponins on responses induced by various receptor stimuli. Eur. J. Pharmacol., 369,23-32 (1999)

상세보기
Ro, J.Y., Ahn, Y.S. and Kim, K.H., Inhibitory effect of ginsenoside on the mediator release in the guinea pig lung mast cells activated by specific antigen-antibody reactions. Int. J. Immunapharmacol. 20, 625-641 (1998)

상세보기
Park, E.K., Choo, M.K., Han, M.J. and Kim, D.H., Ginsenoside Rh1 possesses antiallergic and anti-inflammatory activities. Int. Arch. Allergy Immunol. 133, 113-120 (2004)

상세보기
Choo, M.K., Park, E.K., Han, M.J. and Kim, D.H., Antiallergic activity of ginseng and its ginsenosides. Planta Med. 69, 518-522 (2003)

상세보기
Park, E.K., Choo, M.K., Kim, E.J., Han, M.J. and Kim, D.H., Antiallergic activity of ginsenoside Rh2. Biol. Pharm. Bull. 26, 1581-1584 (2003)

상세보기
Katayama, S., Shionoya, H. and Ohtake, S. : A new method for extraction of extravasated dye in the skin and the influence of fasting stress on passive cutaneous anaphylaxis in guinea pigs and rats. Microbiol. Immunol. 22, 89-10 I (1978)
Fujii, Y., Takeuchi, H., Tanaka, K., Sakuma, S., Ohkubo, Y. and Mutoh, S. : Effects of FK-506 (tacrolimus hydrate) on chronic oxazolone-induced dermatitis in rats. Eur. J. Pharmacol. 456, 115-121 (2002)

상세보기
Chi, Y.S., Lim, H., Park, H. and Kim, H.P.: Effect of wogonin, a plant flavone from Scutellariae Radix, on skin inflammation: in vivo regulation of inflammation-associated gene expression. Biochem. Pharmacol. 66, 1271-1278 (2003)

상세보기
Ishihara, T., Kohno, K., Ushio, S., Iwaki, K., Ikeda, M. and Kurimoto, M. : Tryptanthrin inhibits nitric oxide and prostaglandin $E_2$ synthesis by murine macrophages. Eur. J. Pharmacol. 407, 197-204 (2000)

상세보기
Bachert, C. and van Cauwenberge, P.: The WHO ARIA (allergic rhinitis and its impact on asthma) initiative. Chem. Immunol. Allergey 82, 119-26 (2003)
Stevens, R.L. and Austen, K.F. : Recent advances in the cellular and molecular biology of mast cells. Immunology Today 10, 381-386 (1989)

상세보기
Abd-El-Aleem, S.A, Feguson, M.W., Appleton, I., Bhowmick, A., McCollum, C.N. and Ireland, G W. : Expression of cyclooxygenase isoforms in normal human skin and chromic venous ulcers. J. Pathol. 195, 616-623 (2001)

상세보기
Bruch-Gerharz, D., Fehsel, K., Suschek, C., Michel, G., Ruzicka, T. and Kolba-Bachofen, V. : A proinflammatory activity of interleukin-8 in human skin: expression of the inducible nitric oxide synthase in psoriatic lesions and cultured keratinocytes. J. Exp. Med. 184, 2007-2012 (1996)

상세보기
Bruch-Gerharz, D., Ruzicka, T. and Kolb-Bachofen, V.: Nitric oxide in human skin: current status and future prospects. J. Invest. Dermatol. 110, 1-7 (1998)

상세보기
Hernandez, G.L., Volpert, O.V., Iniguez, M.A., Lorenzo, E., Martinez-Martinez, S., Grau, R., Fresno, M. and Redondo, J.M.: Selective inhibition of vascular endothelial growth factor-mediated angiogenesis by cyclosporin A: roles of the nuclear factor of activated T cells and cyclooxygenase 2. J. Exp. Med. 193, 607-620 (2001)

상세보기

저자의 다른 논문 :

원문 URL 링크

DOI : 10.5142/JGR.2005.29.2.080
DBPia : 저널
AccessON : 저널

*원문 PDF 파일 및 링크정보가 존재하지 않을 경우 KISTI DDS 시스템에서 제공하는 원문복사서비스를 사용할 수 있습니다.

오픈액세스(OA) 유형

BRONZE

출판사/학술단체 등이 한시적으로 특별한 프로모션 또는 일정기간 경과 후 접근을 허용하여, 출판사/학술단체 등의 사이트에서 이용 가능한 논문

내보내기 메뉴

내보내기 구분

파일저장
인쇄
메일전송

구성항목

기본정보
상세정보

관리번호, 논문명, 저널/프로시딩명, 저자 , 발행년, 권, 호, 시작페이지, 끝페이지, 발행기관

저장형식

Text(ASCII format)
Excel format
RefWorks Direct Export
RIS format (for Reference Manager, ProCite, EndNote), Scholar's Aids, Mendeley

메일정보

받는사람 (필수): @
보내는사람 (선택): @
제목
내용: KISTI 검색결과 이메일 서비스

안내

총 건의 자료가 검색되었습니다.

다운받으실 자료의 인덱스를 입력하세요. (1-10,000)

검색결과의 순서대로 최대 10,000건 까지 다운로드가 가능합니다.

데이타가 많을 경우 속도가 느려질 수 있습니다.(최대 2~3분 소요)

다운로드 파일은 UTF-8 형태로 저장됩니다.
파일의 내용이 제대로 보이지 않을실 때는 웹브라우저 상단의 보기 -> 인코딩 -> 자동선택 여부를 확인하십시오.

Text(ASCII format)
Excel format

표제어: PCR

동의어: Packet Collision Rate

용어 설명 출처 목록 (6)

용어 설명: PCR은 세균 특이성이 있는 primer를 이용하여 적은 수의 세균이 있을지라도 쉽게 검출할 수 있는 유용한 방법이며, 이를 이용하여 구강 내 치면세균막이나 타액에서 직접 세균을 검출할 수 있게 되었다[8].

AI-Helper ※ AI-Helper는 을 사용합니다.

AI-Helper

안녕하세요, AI-Helper입니다. 좌측 "선택된 텍스트"에서 텍스트를 선택하여 요약, 번역, 용어설명을 실행하세요.
※ AI-Helper는 부적절한 답변을 할 수 있습니다.

연합인증