$\require{mediawiki-texvc}$

연합인증

연합인증 가입 기관의 연구자들은 소속기관의 인증정보(ID와 암호)를 이용해 다른 대학, 연구기관, 서비스 공급자의 다양한 온라인 자원과 연구 데이터를 이용할 수 있습니다.

이는 여행자가 자국에서 발행 받은 여권으로 세계 각국을 자유롭게 여행할 수 있는 것과 같습니다.

연합인증으로 이용이 가능한 서비스는 NTIS, DataON, Edison, Kafe, Webinar 등이 있습니다.

한번의 인증절차만으로 연합인증 가입 서비스에 추가 로그인 없이 이용이 가능합니다.

다만, 연합인증을 위해서는 최초 1회만 인증 절차가 필요합니다. (회원이 아닐 경우 회원 가입이 필요합니다.)

연합인증 절차는 다음과 같습니다.

최초이용시에는
ScienceON에 로그인 → 연합인증 서비스 접속 → 로그인 (본인 확인 또는 회원가입) → 서비스 이용

그 이후에는
ScienceON 로그인 → 연합인증 서비스 접속 → 서비스 이용

연합인증을 활용하시면 KISTI가 제공하는 다양한 서비스를 편리하게 이용하실 수 있습니다.

Genetic characteristics of the Korean isolate KI -1 of Toxoplasma gondii 원문보기

The Korean journal of parasitology, v.43 no.1 = no.133, 2005년, pp.27 - 32  

LIN Aifen (Department of Parasitology and Tropical Medicine, Seoul National University College of Medicine, and Institute of Endemic Diseases, Seoul National University Medical Research Center) ,  SHIN Eun-Hee (Department of Parasitology and Tropical Medicine, Seoul National University College of Medicine, and Institute of Endemic Diseases, Seoul National University Medical Research Center) ,  KIM Tae-Yun (Institute of Malariology and Department of Parasitology, Inje University College of Medicine) ,  PARK Jae-Hwan (Department of Parasitology and Tropical Medicine, Seoul National University College of Medicine, and Institute of Endemic Diseases, Seoul National University Medical Research Center) ,  GUK Sang-Mee (Department of Parasitology and Tropical Medicine, Seoul National University College of Medicine, and Institute of Endemic Diseases, Seoul National University Medical Research Center) ,  CHAI Jong-Yil (Department of Parasitology and Tropical Medicine, Seoul National University College of Medicine, and Institute of Endemic Diseases, Seoul National University Medical Res)

Abstract ▼ AI-Helper 아이콘AI-Helper

Toxoplasma gondii tachyzoites were isolated from an ocular patient in the Republic of Korea and maintained in the laboratory (designated KI-1). In the present study, its genotype was determined by analyzing dense granule antigen 6 (GRA6) gene and surface antigen 2 (SAG2) gene as typing markers. Dige...

주제어

#Toxoplasma gondii   #Korean isolate-1 (KI-1)   #PCR-RFLP   #sequence  

AI 본문요약
AI-Helper 아이콘 AI-Helper

* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.

제안 방법

  • The SAG1, ROP1, and GRA8 genes of RH and KI-1 were amplified, using the primers made in this study; F (ACGAATTCGACGAGTATGTTT) and R (ACGAA- TTCAACGGTGATC) for SAG1, F (ATGGAG- CAAAGGCTG CCAAT) and R (TTATTGCGATC- CATCATCCTG) for ROP1, and F (ATGGCTTTAC- CATTGCGTG) and R (TTAATTCTGCGTCGTTA CGG) for GRA8. The PCR products were purified using a QIAGEN® II gel extraction kit (QIAGEN, and sequenced on an automated sequencer (Models 373A and 377, PE Applied Biosystems) by the dideoxy­ mediated chain termination method.

대상 데이터

  • ) and Sequence Navigator (PE Applied Biosystems) software. Nucleotide sequence data obtained in this study have been deposited in the GenBank (Bethesda, Maryland, U.S.A.), under the accession numbers AY661790 (ROP1) and AY661791 (SAG1).
  • Briefly, the reaction buffer con­taining 25 mM MgCl2/ deoxynucleotide mix, RNase inhibitor, and reverse transcriptase were mixed in a sterile microfuge tube to produce a Master Mix. This sample was divided into 6 tubes; oligo-p(dT)15 primer was used in 3 tubes and random primer p(dN)6 in the remainder (one each for KI-1 and RH RNA, and a positive control). The tubes were then briefly vortexed, centrifuged, and incubated at 25°C for 10 min and then at 42°C for 60 min.

이론/모형

  • genes of RH and KI-1 were amplified, using the primers made in this study; F (ACGAATTCGACGAGTATGTTT) and R (ACGAA- TTCAACGGTGATC) for SAG1, F (ATGGAG- CAAAGGCTG CCAAT) and R (TTATTGCGATC- CATCATCCTG) for ROP1, and F (ATGGCTTTAC- CATTGCGTG) and R (TTAATTCTGCGTCGTTA CGG) for GRA8. The PCR products were purified using a QIAGEN® II gel extraction kit (QIAGEN, and sequenced on an automated sequencer (Models 373A and 377, PE Applied Biosystems) by the dideoxy­ mediated chain termination method. The primers for PCR amplification were also used for the sequencing reactions.
본문요약 정보가 도움이 되었나요?

참고문헌 (14)

  1. Chai JY, Lin A, Shin EH, Oh MD, Han ET, Nan HW, Lee SH (2003) Laboratory passage and characterization of an isolate of Toxoplasma gondii from an ocular patient in Korea. Korean J Parasitol 41: 147-154 

    원문보기 상세보기 crossref

  2. Dubey JP, Graham DH, Blackston CR, Lehmann T, Gennari SM, Ragozo AM, Nishi SM, Shen SK, Kwok OC, Hill DE, Thulliez P (2002) Biological and genetic characterization of Toxoplasma gondii isolates from chickens (Gallus domesticus) from Sao Paulo, Brazil: unexpected findings. Int J Parasitol 32: 99-105 

    상세보기 crossref

  3. Fazaeli A, Carter PE, Darde ML, Pennington TH (2000a) Molecular typing of Toxoplasma gondii strains by GRA6 gene sequence analysis. Int J Parasitol 30: 637-642 

    상세보기 crossref

  4. Fazaeli A, Carter PE, Pennington TH (2000b) Intergenic spacer (IGS) polymorphism: a new genetic marker for differentiation of Toxoplasma gondii strains and Neospora caninum. J Parasitol 86: 716-723 

    상세보기 crossref

  5. Grigg ME, Bonnefoy S, Hehl AB, Suzuki Y, Boothroyd JC (2001a). Success and virulence in Toxoplasma as the result of sexual recombination between two distinct ancestries. Science 294: 161-165 

    상세보기 crossref

  6. Grigg ME, Ganatra J, Boothroyd JC, Margolis TP (2001b) Unusual abundance of atypical strains associated with human ocular toxoplasmosis. J Infect Dis 184: 633-639 

    상세보기 crossref

  7. Hogdall E, Vuust J, Lind P, Petersen E (2000) Characterization of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences. Int J Parasitol 30: 853-858 

    상세보기 crossref

  8. Howe DK, Honore S, Derouin F, Sibley LD (1997) Determination of genotypes of Toxoplasma gondii strains isolated from patients with toxoplasmosis. J Clin Microbiol 35: 1411-1414 

    상세보기

  9. Howe DK, Sibley LD (1995) Toxoplasma gondii comprises three clonal lineages: Correlation of parasite genotype with human disease. J Infect Dis 172: 1561-1566 

    상세보기 crossref

  10. Johnson AM (1998) Is there more than one species in the genus Toxoplasma? Tokai J Exp Clin Med 23: 383-389 

  11. Lehmann T, Blackston CR, Parmley SF, Remington JS, Dubey JP (2000) Strain typing of Toxoplasma gondii: comparison of antigen-coding and housekeeping genes. J Parasitol 86: 960-971 

    상세보기 crossref

  12. Lyons RE, Johnson AM (1998) Gene sequence and transcription differences in 70 kDa heat shock protein correlate with murine virulence of Toxoplasma gondii. Int J Parasitol 28: 1041-1051 

    상세보기 crossref

  13. Sibley LD, Boothroyd JC (1992) Virulent strains of Toxoplasma gondii comprise a single clonal lineage. Nature 359: 82-85 

    상세보기 crossref

  14. Suzuki Y, Conley FK, Remington JS (1989) Differences in virulence and development of encephalitis during chronic infection vary with the strain of Toxoplasma gondii. J Infect Dis 159: 790-794 

    상세보기 crossref

저자의 다른 논문 :

관련 콘텐츠

오픈액세스(OA) 유형

BRONZE

출판사/학술단체 등이 한시적으로 특별한 프로모션 또는 일정기간 경과 후 접근을 허용하여, 출판사/학술단체 등의 사이트에서 이용 가능한 논문

섹션별 컨텐츠 바로가기

AI-Helper ※ AI-Helper는 오픈소스 모델을 사용합니다.

AI-Helper 아이콘
AI-Helper
안녕하세요, AI-Helper입니다. 좌측 "선택된 텍스트"에서 텍스트를 선택하여 요약, 번역, 용어설명을 실행하세요.
※ AI-Helper는 부적절한 답변을 할 수 있습니다.

선택된 텍스트

맨위로