A DNA vaccine methodology using eukaryote expression vectors to produce immunizing proteins in the vaccinated hosts is a novel approach to the development of vaccine and immuno-therapeutics, and it has achieved considerable success over several infectious diseases and various cancers. To further enh...
A DNA vaccine methodology using eukaryote expression vectors to produce immunizing proteins in the vaccinated hosts is a novel approach to the development of vaccine and immuno-therapeutics, and it has achieved considerable success over several infectious diseases and various cancers. To further enhance its efficiency, attempts were made to develop novel plasmid vectors containing multiple immunostimulatory CpG motifs, for rapid and strong immune response. First, a 2.9 kb compact plasmid vector (pVAC), containing CMV promoter, polycloning site, BGH poly(A) terminator, ampicillin resistance gene and pBR322 origin was constructed. A pVAC-hEPO was also constructed, which contained a human erythropoietin gene, for evaluating the transfection efficiency of naked plasmid DNA both in vitro and in vivo. To examine the adjuvant effect of multi-CpG motifs on naked plasmid DNA, 22 and 44 enriched and unmethylated CpG motifs were introduced into pVAC to generate pVAC-ISS1 and pVAC-ISS2, respectively. $100{\mu}g$ of pSecTagB, pVAC, pVAC-ISS1 or pVAC-ISS2 were each injected intramuscularly into the tibilias anterior muscle of Balb/c mice. The level of interleukin-6 induced in the mice injected with pVAC-ISS1 and pVAC-ISS2 were significantly elevated after 12 hours, which were almost 2 and 2.5 times higher than that in the mice injected with pSecTagB, respectively. These results suggest that DNA vaccine plasmids with enriched CpG motifs can induce rapid secretion of interleukin-6 by lymphocytes. In conclusion, these vectors can contribute to the development of adjuvant-free DNA vaccinations against infectious diseases and various cancers.
A DNA vaccine methodology using eukaryote expression vectors to produce immunizing proteins in the vaccinated hosts is a novel approach to the development of vaccine and immuno-therapeutics, and it has achieved considerable success over several infectious diseases and various cancers. To further enhance its efficiency, attempts were made to develop novel plasmid vectors containing multiple immunostimulatory CpG motifs, for rapid and strong immune response. First, a 2.9 kb compact plasmid vector (pVAC), containing CMV promoter, polycloning site, BGH poly(A) terminator, ampicillin resistance gene and pBR322 origin was constructed. A pVAC-hEPO was also constructed, which contained a human erythropoietin gene, for evaluating the transfection efficiency of naked plasmid DNA both in vitro and in vivo. To examine the adjuvant effect of multi-CpG motifs on naked plasmid DNA, 22 and 44 enriched and unmethylated CpG motifs were introduced into pVAC to generate pVAC-ISS1 and pVAC-ISS2, respectively. $100{\mu}g$ of pSecTagB, pVAC, pVAC-ISS1 or pVAC-ISS2 were each injected intramuscularly into the tibilias anterior muscle of Balb/c mice. The level of interleukin-6 induced in the mice injected with pVAC-ISS1 and pVAC-ISS2 were significantly elevated after 12 hours, which were almost 2 and 2.5 times higher than that in the mice injected with pSecTagB, respectively. These results suggest that DNA vaccine plasmids with enriched CpG motifs can induce rapid secretion of interleukin-6 by lymphocytes. In conclusion, these vectors can contribute to the development of adjuvant-free DNA vaccinations against infectious diseases and various cancers.
* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.
제안 방법
l). The pVAC-hEPO and pSecTa흥B・hEPO plasmids were constructed by inserting the human erythropoietin (hEPO) gene into the HindlH and Xbal recognition sites of pVAC and pSecTagB, respectively (Fig.l).
Therefore, this result reassures the previous finding that the size of plasmid vectors is one of the important factors related to the transfection efficiency of various DNA vaccines based on naked plasmid DNA [12]. To determine the adjuvant effect of enriched CpG motifs on pVAC-ISSl and pVAC-lSS2, 100 μg of pSecTagB, pVAC, pVAC-ISSl or pVAC-ISS2 were each injected i.m. into the tibilias anterior muscle of Balb/c mice. The pVAC- ISS1 has a single ISS cassette, which contains 22 repeating CpG motifs and the pVAC-ISS2 has double ISS cassettes, which contain 44 repeating CpG motifs.
대상 데이터
The 6-week-old female Balb/c mice were obtained from the Seoul National University Laboratory Animal Center and maintained under specific pathogen-free and standard conditions with a 12-h light-dark cycle. NIH3T3 (mouse fibroblast) and COS-7 (monkey kidney) cell lines were purchased from the Korean Cell Line Bank (KCLB) (Seoul, Korea). All culture media and fetal bovine serum were obtained from GIBCO/BRL (Carlsbad, CA, USA).
2). The 6-week-old female Balb/c mice were injected with 100 pg of the pVAC, pVAC-hEPO, and pSecTagB-hEPO into the tibilias anterior muscle and with PBS as a negative control. The same muscles were treated with cardi- toxin before injection of the plasmids to induce muscle degeneration and regeneration as previously described[11].
The 6-week-old female Balb/c mice were obtained from the Seoul National University Laboratory Animal Center and maintained under specific pathogen-free and standard conditions with a 12-h light-dark cycle. NIH3T3 (mouse fibroblast) and COS-7 (monkey kidney) cell lines were purchased from the Korean Cell Line Bank (KCLB) (Seoul, Korea).
Phosphodiester oligodeoxynucleotides (ODN) which contain enriched CpG motifs were synthesized with a 5’ phosphorylated end by Bioneer (Daejeon, Korea). The ODN used herein were: 5, PGATCCAAAAGACGTTGAC GT1AAAGACGTTAAQCGTCAAA 3' (41-mer), 5' PCC CGCCCGCCCCCCCCAACGTTAACGTTGACGTCGAC GTCGCGGACGTTCCA 3' (54-mer), 5 PGATCTGGAA CGTCCGCGACGTCGACGT CAACGTTAACGTT 3' (41-mer), and 5, PGGGGGGGGCGGGGCGGGTTTT GACGTIAACGTCTTIAACGTCAACGTCTTTT 3' (53- mer). All ODNs were hybridized with each other by boiling for 10 minutes then cooled slowly to room temperature.
To construct pVAC, 1, 201 base pair fragment obtained by PCR of pSecTagB with sense and antisense primers. The primers were 5, TTTTTTAAIAAT(SspI)GG ATCC(BamHI) CGATGTACGGGCCAGAT 3 and 5' TTTTTTGATTC (TfiI)AGATCT(BgllI)TCCCCAGCATGCCTGCT 3; respectively. Restriction sites of BamHI and Bglll were introduced to the fragment for the further cloning strategy.
The restriction endonucleases, T4 DNA ligase, and vent DNA polymerase, were purchased from New England Biolabs (Beverly, MA, USA). The pSecTag B was purchased from Invitrogen (Carlsbad, CA, USA) and the pUC19 was purchased from Novagen (Darmstadt, Germany) .
성능/효과
In this study, it was demonstrated that novel plasmid vectors for the induction of early immune responses can result in an improvement in therapeutic gene therapy based on plasmid DNA. Firstly, a 2.
T3 cells, and a competitive enzyme-linked immunosorbent assay (ELISA) was performed to detect expressed and secreted hEPO levels. The hEPO expression level of transfected pVAC-hEPO was found to be significantly elevated: two times higher than that of the transfected pSecTagB-hEPO in the case of COS-7 and four times higher than in the case of NIH3T3 (Fig. 2). The 6-week-old female Balb/c mice were injected with 100 pg of the pVAC, pVAC-hEPO, and pSecTagB-hEPO into the tibilias anterior muscle and with PBS as a negative control.
The hEPO expression in the blood sample increased approximately two-fold with the pVAC-hEPO compared with that of the pSecTagB -hEPO. These results show that pVAC-hEPO, the smallest of the constructed vectors, was the most effective vector for hEPO expression both in vitro and in vivo and an enhancement of EPO producing ability of pVAC-hEPO could guarantee an increased efficiency of direct plasmid delivery into the skeletal muscles in vivo. Therefore, this result reassures the previous finding that the size of plasmid vectors is one of the important factors related to the transfection efficiency of various DNA vaccines based on naked plasmid DNA [12].
참고문헌 (22)
Hele, T., C. Maripat, R. Mark, and R. Eyal (1998) Gene vaccination: Plasmid DNA is more than just a blueprint. Immunol. Today 19: 89-97
Yoshtsugu, K., X. Ke-Qin, O. Takaki, H. Kenji, O. Tomohiro, S. Kaori, O. Tomomi, H. Yuka, J. Nao, N. Masatoshi, K. Dennis, and O. Kenji (2002) Adjuvant effect of multi- CpG motifs on an HIV-1 DNA vaccine. Vaccine 20: 2857- 2865
Yi, A. K., D. M. Klinman, T. L. Martin, S. Matson, and A. Krieg (1996) Rapid immune activation by CpG motifs in bacterial DNA: Systemic induction of IL-6 transcription through an antioxidant-sensitive pathway. J. Immunol. 157: 5394-5402
Krieg, A. M., A. K. Yi, S. Matson, T. J Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, and D. M. Klinman (1995) CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374: 546-549
Klinman, D. M., J. Conover, J. M. Leiden, A. S. Rosenberg, and J. M. Sechler(1999) Safe and effective regulation of hematocrit by gene gun administration of an erythropoietin- encoding DNA plasmid. Hum. Gene Ther. 10: 659-665
Duchen, L. W., B. J. Excell, R. Patel, and B. Smith (1974) Changes in motor end-plates resulting from muscle fiber necrosis and regeneration: A light and electron microscopic study of the effects of the depolarizing fraction (cardiotoxin) of Dendroaspis jamesoni venom. J. Neurol. Sci. 21: 391-417
Herrera, A. B., E. G. Rodriguez, T. Hernandez, B. Sandez, and C. A. Duarte (2000) A family of compact plasmid vectors for DNA immunization in humans. Biochem Biophys. Res. Commun. 279: 548-551
Klinman, D. M. and A. K. Yi (1996) CpG motifs present in bacterial DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon $\gamma$ . Proc. Natl. Acad. Sci. USA 93: 2879-2883
Tripathy, S. K., E. C. Svensson, H. B. Black, E. Goldwasser, M. Margalith, P. M. Hobart, and J. M. Leiden (1996) Long-term expression of erythropoietin in the systemic circulation of mice after intramuscular injection of a plasmid DNA vector. Proc. Natl. Acad. Sci. USA 93: 10876-10880
Mennuni, C., F. Calvaruso, I. Zampaglione, G. Rizzuto, D. Rinaudo, E. Dammassa, G. Ciliberto, E. Fattori, and N. La Monica (2002) Hyaluronidase increases electrogene transfer efficiency in skeletal muscle. Hum. Gene Ther. 13: 355-365
Mir, L. M., M. F. Bureau, J. Gehl, R. Rangara, D. Rouy, J. M. Caillaud, P. Delaere, D. Branellec, B. Schwartz, and D. Scherman (1999) High-efficiency gene transfer into skeletal muscle mediated by electric pulses. Proc. Natl. Acad. Sci. USA 96: 4262-4267
Lee, H. S., J. H. Jeong, J. H. Lee, and T. G. Park (2001) Enhancing transfection efficiency using polyethylene glycol grafted polyethylenimine and fusogenic peptide. Biotechnol. Bioprocess Eng. 6: 269-273
Kim, Y. J., T. W. Kim, H. S. Chung, I. C. Kwon, and S. Y. Jeong (2001) Counterion effects on transfection activity of cationic lipid emulsion. Biotechnol. Bioprocess Eng. 6: 279-283
※ AI-Helper는 부적절한 답변을 할 수 있습니다.