[국내논문]Plasminogen kringle 5 재조합 단백질에 의한 ERK1/2 활성화 및 세포골격 재배열 억제 Inhibition of ERK1/2 Activation and Cytoskeleton Rearrangement by the Recombinant Protein of Plasminogen Kringle 5원문보기
Plasminogen kringle 5는 plasminogen kringles 1-4로 구성된 내생의 혈관 신생 억제제인 angiostatin과 같이 내피세포의 분열을 강력하게 억제한다고 알려져 있다. 본 연구에서는 plasminogen kringle 5의 재조합 단백질을 효모 발현 체계에서 생산하여 내피세포의 이동에 대한 저해 효과와 이에 대한 작용기전을 조사하였다 재조합 단백질 PK5는 plasminogen의 Thr456에서 Phe546까지 이르는 cDNA 부분을 ${\alpha}-factor$ prepro-peptide의 분비 신호 서열 뒤에 도입하여 Pichia pastoris GS115에서 발현시켰다. 메탄올 유도 후 얻은 배양액을 S-spin column을 이용하여 정제하였다. 정제된 단백질을 SDS-PACE하였을 때 약 10kDa의 단일 밴드를 나타냄을 확인할 수 있었다. 정제된 PK5는 bFGF나 VEGF에 의해 유도된 인간의 제대 유래 내피 세포의 이동을 약 500nM의 $IC_{50}$ 값으로 농도 의존적으로 감소시켰다. 내피 세포에 PK5 500M을 처리한 결과 bFGF에 의해 유도된 ERK1/2의 인산화를 감소시켰다 또한, PK5는 bFGF에 의해 유도된 내피세포의 골격 재형성을 강력하게 억제하는 것으로 관찰되었다. 따라서, 이러한 결과들은 효모 생산 PK5가 내피세포의 이동을 효과적으로 억제하며, 이는 ERK1/2의 활성과 세포골격의 재배열을 억제함으로써 나타나는 것으로 부분적으로 설명될 수 있다.
Plasminogen kringle 5는 plasminogen kringles 1-4로 구성된 내생의 혈관 신생 억제제인 angiostatin과 같이 내피세포의 분열을 강력하게 억제한다고 알려져 있다. 본 연구에서는 plasminogen kringle 5의 재조합 단백질을 효모 발현 체계에서 생산하여 내피세포의 이동에 대한 저해 효과와 이에 대한 작용기전을 조사하였다 재조합 단백질 PK5는 plasminogen의 Thr456에서 Phe546까지 이르는 cDNA 부분을 ${\alpha}-factor$ prepro-peptide의 분비 신호 서열 뒤에 도입하여 Pichia pastoris GS115에서 발현시켰다. 메탄올 유도 후 얻은 배양액을 S-spin column을 이용하여 정제하였다. 정제된 단백질을 SDS-PACE하였을 때 약 10kDa의 단일 밴드를 나타냄을 확인할 수 있었다. 정제된 PK5는 bFGF나 VEGF에 의해 유도된 인간의 제대 유래 내피 세포의 이동을 약 500nM의 $IC_{50}$ 값으로 농도 의존적으로 감소시켰다. 내피 세포에 PK5 500M을 처리한 결과 bFGF에 의해 유도된 ERK1/2의 인산화를 감소시켰다 또한, PK5는 bFGF에 의해 유도된 내피세포의 골격 재형성을 강력하게 억제하는 것으로 관찰되었다. 따라서, 이러한 결과들은 효모 생산 PK5가 내피세포의 이동을 효과적으로 억제하며, 이는 ERK1/2의 활성과 세포골격의 재배열을 억제함으로써 나타나는 것으로 부분적으로 설명될 수 있다.
Plasminogen kringle 5 is a potent inhibitor of endothelial tell proliferation like an endogenous angiogenesis inhibitor, angiostatin consisting of plasminogen kringles 1-4. In this study, we produced the recombinant protein of plasminogen kringle 5 (PK5) employing an Pichia expression system and exa...
Plasminogen kringle 5 is a potent inhibitor of endothelial tell proliferation like an endogenous angiogenesis inhibitor, angiostatin consisting of plasminogen kringles 1-4. In this study, we produced the recombinant protein of plasminogen kringle 5 (PK5) employing an Pichia expression system and examined its. effect on~endothelial cell migration and its possible inhibitory mechanism. PK5 was expressed in Pichia pastoris GS115 by fusion of the cDNA spanning from Thr456 to Phe546 to the secretion signal sequence of a-factor prepro-peptide. After methanol induction, the secreted PK5 was purified by using S-spin column. SDS-PACE analysis of the purified protein showed one major band of approximately 10kDa. In in vitro migration assays, the purified protein inhibited dose-dependently the migration of human umbilical endothelial cells (HUVECs) induced by basic fibroblast growth factor (bFGF) or vascular endothelial growth factor (VEGF) with an $IC_{50}$ of approximately 500nM. Accordingly, it inhibited bfGF-stimulated extracellular signal-regulated kinase 1/2 (ERK1/2) phosphorylation in HUVECs at 500nM. In addition, it also potently inhibited bFGF-induced cytoskeletal rearrangement of HUVECs. Thus, these results suggest that Pichia-produced PK5 effectively inhibits endothelial cell migration, in part by suppression of ERK1/2 activation and blocking cytoskeleton rearrangement.
Plasminogen kringle 5 is a potent inhibitor of endothelial tell proliferation like an endogenous angiogenesis inhibitor, angiostatin consisting of plasminogen kringles 1-4. In this study, we produced the recombinant protein of plasminogen kringle 5 (PK5) employing an Pichia expression system and examined its. effect on~endothelial cell migration and its possible inhibitory mechanism. PK5 was expressed in Pichia pastoris GS115 by fusion of the cDNA spanning from Thr456 to Phe546 to the secretion signal sequence of a-factor prepro-peptide. After methanol induction, the secreted PK5 was purified by using S-spin column. SDS-PACE analysis of the purified protein showed one major band of approximately 10kDa. In in vitro migration assays, the purified protein inhibited dose-dependently the migration of human umbilical endothelial cells (HUVECs) induced by basic fibroblast growth factor (bFGF) or vascular endothelial growth factor (VEGF) with an $IC_{50}$ of approximately 500nM. Accordingly, it inhibited bfGF-stimulated extracellular signal-regulated kinase 1/2 (ERK1/2) phosphorylation in HUVECs at 500nM. In addition, it also potently inhibited bFGF-induced cytoskeletal rearrangement of HUVECs. Thus, these results suggest that Pichia-produced PK5 effectively inhibits endothelial cell migration, in part by suppression of ERK1/2 activation and blocking cytoskeleton rearrangement.
* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.
문제 정의
따라서, 본 연구에서는 Pichia pastoris로부터 plasminogen kringle 5를 재조합 단백질로 발현, 정제하고, 정제된 단백질이 내피세포 이동을 효과적으로 저해하는지 조사하였고, PK5의 내피세포 이동 억제 작용에 대한 작용기전에 알아보기 위해, 내피세포 이동에 중요한 신호 전달계인 ERK 1/2의활성화와 세포골격의 재배열에 어떠한 영향을 주는지 조사하였다.
분열을 강력하게 억제한다고 알려져 있다. 본 연구에서는 plasminogen kringle 5의 재조합 단백질을 효모 발현 체계에서 생산하여 내피세포의 이동에 대한 저해 효과와 이에 대한 작용기전을 조사하였다. 재조합 단백질 PK5는 plasmi- nogen의 Thr456에서 Phe546까지 이르는 cDNA 부분을 a -factor prepro-peptide의 분비 신호 서열 뒤에 도입하여 Pichia pastoris GS115에서 발현시켰다.
정제한 재조합 PK5가 일차 배양한 내피세포의 이동에 어떠한 영향을 미치는 지 조사하였다. 먼저, wound migration assay에서 bFGF에 의해 유도된 내피세포 이동에 대한 효과를 보았을 때, 정제된 재조합 PK5가 1-1000 nM 농도 범위에서 농도 의존적으로 이동을 억제 하였다(Fig.
제안 방법
Boy den-chamber의아랫부분과 윗부분 사이에 세포가 통과할 수 있도록 8 iim의구멍 크기의 막을 넣고 조립하고, 챔버의 윗부분에 준비한 세포들을 2 X 104 개씩 (56 pl) 넣어주었다. 5% CO존재 하 37℃에서 약 4 시간에 걸쳐 세포 이동을 실시하였으며 이동이 끝난 막은 H&E 염색을 실시하여 웰 마다 5 시야를 무작위로 촬영하여 이동한 세포 수를 계산하였다.
대조군은 bFGF 없이 1% FBS가 첨가된 EBM-2 배지에서 배양하였다. 8 시간 후에 나화된 지역으로 이동된 세포는 Olympus C-5050 디지털 카메라로 촬영하였고, 이동한 세포 수를 계수하였다.
Boy den-chamber 를 이용한 내피세포 이동 실험은 혈청이 첨가되지 않은 EBM-2 배지에서 내피세포를 4 시간동안 배양하고 PK5를 30분간 전처리 하였다. 혈청이 첨가되지 않은 EBM-2 배지나 VEGF를 2 ng/ml 농도로 가훈! 배지를 보이든챔버의 아랫부분에 27 pl 씩 넣어주었다.
Kringle로서 가장 강력하게 내피세포 증식을 억제하는 것으로 알려진 PK5를(1) 재조합 단백질로 발현하기 위하여, Thr456부터 Phe546에 이르는 plasminogen의 서열을 암호화하는 cDNA 부분에 대해 PCR 증폭을 수행하여 pPICZa-C 벡터의 Cla I -Xba I. site에 in frame으로 클로닝 하였다. 제한효소 Cla I, Xba I 으로 잘랐을 때-삽입 된 DNA가.
Plasminogen kringle 5 (PK5) 발현 벡터를 제작하기 위하여 목암 생명 공학 연구소의 윤엽 박사로부터 제공받은 PK5 cDNA 를 주형으로 kringle 특이 5'-primer (PK5 5Z- CAGTATCGATCACTCCTTCCGAAGAAGAC)와 T-primer (PK5 3/-CTGATCTAGATCAAAATGAAGGGGCCGQ> Pfu중합효소를 이용한 PCR을 수행하여 kringle에 해당하는 DNA 조각만을 denaturation (95℃/ 1 분), annealing(55℃/ 1 분), extension(72cC, 12 분)의 조건으로 30회 반응시켜 증폭시켰다. 이때 얻어진 DNA 단편을 Cla I 과 Xba I 을 이용하여, pPICZa-C 벡터에 클로닝 하였다.
영향을 미친다[18, 26]. bFGF에 의해 유도된 세포골격의 재배열에 PK5가 어떤 영향을 미치는지를 알아보기 위해 phallodin과 vinculin항체로 세포 면역 염색을 실시하였다. bFGF만을 처리한 세포는 세포 전반에 걸쳐 actin stress fiber가 형성 되는 것이 확인된 반면 PK5를 30 분간 전처리 한 세포들에서는 이러한 actin stress fiber 형성이 전반적으로 억제 되는 것이 관찰되었다(Fig.
1% Tween 20)으로 처리한 후, TEST로 10 분씩 3회 세척하였다. phos- pho-ERKl/2 antibody (Cell Signaling, Danvers, MA) 를 1:1000의 비율로 blockin응 완충액에 희석하여 하루 동안 반응 시 킨 후, 이 막을 TBST로 10 분씩 3회 세 척하고 blocking 완충액으로 1:1000 희석한 anti-rabbit IgG-HRP (Cell signal- ing)를 2차 항체로 1시간 동안 반응시켰다. 반응이 끝난 후 TBST로 10 분씩 3회 세척한 후 ECL solution (Amersham, UK)으로 처리 후 X선 필름에 노출시켰다.
이때 얻어진 DNA 단편을 Cla I 과 Xba I 을 이용하여, pPICZa-C 벡터에 클로닝 하였다. 그 후 벡터를'다시추출하여 염기서열을 확인하였고, 재조합 단백질의 발현을 위해, 발현 목적으로 이용되는 P- pastoris GS115 균주에 형질도입 하였다.
pastoris 형질 도입 체를 1,500 X g에서 5 분간 원심분리 한 후, 30개의 군체 각각을 BMMH (buffered minimal methan이 histidine) 2 ml에 현탁하였다. 그 후, 4 일 동안 24 시간마다 최종농도가 0.5%가 되도록 메탄올을 첨가하였고, 단백질이 분비된 배양액을 SDS-PAGE로 분석하여 높은 수율로 발현하는 균주를 선별하였다.
2 pm 니트로셀룰로오스 막에 전기적으로 이동시켰다. 니트로셀 룰로오스 막을 30 분간 blocking 완충액 (5% skim milk in TBST; 10 mM Tris-HCl, pH 8.0z 150 mM NaCl, 0.1% Tween 20)으로 처리한 후, TEST로 10 분씩 3회 세척하였다. phos- pho-ERKl/2 antibody (Cell Signaling, Danvers, MA) 를 1:1000의 비율로 blockin응 완충액에 희석하여 하루 동안 반응 시 킨 후, 이 막을 TBST로 10 분씩 3회 세 척하고 blocking 완충액으로 1:1000 희석한 anti-rabbit IgG-HRP (Cell signal- ing)를 2차 항체로 1시간 동안 반응시켰다.
5%가 되도록 메탄올을 첨가하여 단백질 발현을 유도한 후 군체가 분비한 단백질을 함유한 배양액을 SDS-PAGE 실시한 결과 2 번 군체가 가장 많이 발현하는, 것으로 확인하였다. 따라서, 이를 2 1 BMGH 배지에서 배양한 후, 400 ml BMMH 배지로 교환하여 96 시간 동안 메탄올 유도를 실시한 후, 얻은 배양액을 농축하였고, 투석 후 S-spin 컬럼을 이용하여 정제하였다. 최종적으로 정제한 단백 질은 Bicinchoninic acid assay 분석 에 의해 약 26 mg 얻어진 것을 확인하였다(Fig.
pastoris GS115 80 ug에 형질도입 하였다. 약 10 ㎍의 선형화된 플라스미드 DNA와 P. pastoris 80 ㎍를 0오 cm cuv- ette에서 현탁한 후 Gene pulser (Bio-Rad Hercules, San Jose, CA)를 이용하여 L5 kV, 25 μF, 400 Q의 조건에서 electroporation 방법에 의해 형질도입 하였다. Pulsing 후 즉시 1 M sorbitol 1 ml을 cuvette에 첨가하였고, 30℃에서 1 시간 동안 배양하였다.
5%가 되도록 메탄올을 첨가하여 최종 430 ird의 배양액 중 195 mg의 단백질을 발현하였다. 원심분리 하여 배 양액을 회수한 후 Amicon kit (Beverly, MA)로 농축 시켜 40 ml이 되게 하고 50 mM potassium phosphate buffer, pH 7.2, 350 ml을 넣어 재농축한 후 평형화 완충용액 (20 mM potassium phosphate 완충액, pH 5.5, 20 mM NaCl)으로 투석하였다. 먼저 강 양이온 교환수지가 충진된 S column에 평형화 완충 용액을 5 ml 첨가한 후, 500 x g에서 5 분간 2회 원심 분리하여 컬럼을 평형화시켰다.
이때 얻어진 DNA 단편을 Cla I 과 Xba I 을 이용하여, pPICZa-C 벡터에 클로닝 하였다. 그 후 벡터를'다시추출하여 염기서열을 확인하였고, 재조합 단백질의 발현을 위해, 발현 목적으로 이용되는 P- pastoris GS115 균주에 형질도입 하였다.
재조합 균주로부터 분리한 Pichia 발현 플라스미드 (pPICZa-C/PK5) 10 ㎍을 Sac I 으로 절단하여 선형화 한 후, P. pastoris GS115 80 ug에 형질도입 하였다. 약 10 ㎍의 선형화된 플라스미드 DNA와 P.
신호 전달에 대한 PK5의 영향을 조사하였다. 혈청이 결핍된 배지에서 굶긴 배양 HUVEC에 재조합 PK5를 30 분간전처리한 후 3 ng/ml의 bFGF로 세포를 자극하였다. 대조군으로 TK1-2를 전처리하지 않은 경우 bFGF의 처리 시 15 분 후 ERK1/2가 인산화 되었으나, PK5를 전처리한 세포에서는 인산화 정도가 감소된 것을 관찰할 수 있었다(Fig.
05% tween-20포함된 PBS로 세척하고 마운틴 용액을 이용하여 형광 해상력을 증가시켰다. 형광 이미지는 OLYMPUS AX70 (OLYMPUS, Tokyo, Japan) fluorescence microscope을 통해 관찰하였고 DP70 camera via DP Manger version 2, 1, 1, 163 software (OLYMPUS) < 사-용하여 사진 촬영을 실시하였다.
대상 데이터
Restriction enzymee Roche Molecular Biochemical (Mannheim, Germany)에서, Medium 199 (M199), Dulbescoe modified Eagle's medium (DMEM), fetal bovine serum (FBS), TOPIOF', pPICZa-C vector, P. pastoris GS115 그리고 trypsin solution, Probond™ resime Invitrogen (Carlsbad, CA)에서, PCR에 사용되는 모든 primei들은 Life Technologies (Gland Island, NY)에서, endothelial cell growth supplement (ECGS), heparin, gratin, RNAse A는 Sigma (St. Louis, MO)에서, Basic fibroblast growth factor (bFGF)는 R&D system (Minneapolis, MN)에서, Quikchange multi site-directed mutagenesis kitz DNA polymerase pfu Stratagene (La Jolla, CA)에서, LB broth는 DIFCO (Detroit MI) 에 서, isoprophy-p-D-thiogalactopyranoside (IPTG) 는 Amresco (Solon, OH)에서, DNase I, Xba I z Cla I 은 Boehringer Mannheim (Mannheim, Germany)에서, Glass Econo Columne Bio-Rad (Hercules, CA)에서, Labscale TFF system과 Centricon 100은 Millipore (Bedford, MA) 에서, Anti-vinculin, rhodamine-conjugated phalloidin, FITC (fluorescein isothiocyanate)-labeled secondary antibodies는 Chemicon (Temecula, CA)에서 구입하였다.
세포는 4% paraformaldehydee 고정하고 1% BSA로 비특이적 결합을 없애주었다' Anti-vinculin antibody는 1:1000으로 실온에서 3 시간 동안 반응하였고, FITC가 결합된 2차 항체를 1:500으로 희석하여 반응시켰다. Rhodamin이 결합된 phalloidinA 로 actin을 염색하고 핵 염색을 위해 DAI가를 사용하였다. Coverslipe 0.
이론/모형
bFGF로 자극된 내피세포의 이동에 대한 PK5의 효과는 단층 나화 실험과 Boyden-chamber를 이용한 실험에 의해서 평가되었다. 우선 단층 나화 실험은 내피 세포를 1% gelatin이 도포된 6 well 배양 접시에 EGM-2를 첨가하여 confluency 될 때까지 배양하였다.
내피세포는 Jaffe 등의 방법[기에 의해 사람의 탯줄에서부터 분리하였다. 탯줄의 정맥을 PBS로 세척한 후, collagenase 를 0.
성능/효과
bFGF에 의해 유도된 세포골격의 재배열에 PK5가 어떤 영향을 미치는지를 알아보기 위해 phallodin과 vinculin항체로 세포 면역 염색을 실시하였다. bFGF만을 처리한 세포는 세포 전반에 걸쳐 actin stress fiber가 형성 되는 것이 확인된 반면 PK5를 30 분간 전처리 한 세포들에서는 이러한 actin stress fiber 형성이 전반적으로 억제 되는 것이 관찰되었다(Fig. 4).
pastoris GS115에 electrophoration하는 방법으로 형 질도입시키고 고농도 (1000 ug/ml)의 Zeocin이 포함된 YPD 평판에서 배양하였을 때 약 55개의 단일 군체가 형성되었다. 높은 수율로 단백질을 발현하는 단일 군체를 선별하기 위해서 4 일간 BMMH 배지에 0.5%가 되도록 메탄올을 첨가하여 단백질 발현을 유도한 후 군체가 분비한 단백질을 함유한 배양액을 SDS-PAGE 실시한 결과 2 번 군체가 가장 많이 발현하는, 것으로 확인하였다. 따라서, 이를 2 1 BMGH 배지에서 배양한 후, 400 ml BMMH 배지로 교환하여 96 시간 동안 메탄올 유도를 실시한 후, 얻은 배양액을 농축하였고, 투석 후 S-spin 컬럼을 이용하여 정제하였다.
혈청이 결핍된 배지에서 굶긴 배양 HUVEC에 재조합 PK5를 30 분간전처리한 후 3 ng/ml의 bFGF로 세포를 자극하였다. 대조군으로 TK1-2를 전처리하지 않은 경우 bFGF의 처리 시 15 분 후 ERK1/2가 인산화 되었으나, PK5를 전처리한 세포에서는 인산화 정도가 감소된 것을 관찰할 수 있었다(Fig. 3). 이러한 결과는 PK5가 내피세포의 이동과 관련된 신호 전달계에 이상을 초래함으로써 내피세포의 이동을 억제하는 것으로 보여 진다.
2B). 두 assay 방법에서 ICso (최대 저해 효과의 50% 를 나타내는 농도)는 대략 500 nM로 추정되었다. 따라서, PK5가 이동인자와 관계없이 내피세포 이동을 효과적으로 저해하는 것을 알 수 있었다.
두 assay 방법에서 ICso (최대 저해 효과의 50% 를 나타내는 농도)는 대략 500 nM로 추정되었다. 따라서, PK5가 이동인자와 관계없이 내피세포 이동을 효과적으로 저해하는 것을 알 수 있었다. 이러한 내피 세포 이동 억제 효과는 E.
따라서, 이들의 결과들은 PK5가 세포이동에 관련한 신호전달 과정에 ERK1/2 활성화를 저해하고 세포 이동에 필요한 세포 골격 재배열을 저해하여 내피세포 이동을 억제함을 시 사한다. 이러한 PK5의 억 제 효과는 apolipoprotein kringle V (LK8)의 경우에도 actin stress 형성과 focal adhesion 형성을 저해하는 것이 관찰되어 상응하는 양상을 보인다[14].
또한, PK5는 bFGF에 의해 유도된 내피세포의 골격 재형성을 강력하게 억제하는 것으로 관찰되었다. 따라서, 이러한 결과들은 효모 생산 PK5가 내피세포의 이동을 효과적으로 억제하며, 이는 ERK1/2의 활성과 세포골격의 재배열을 억제함으로써 나타나는 것으로 부분적으로 설명될 수 있다.
2A). 또한 modified Boyden-chamber assay를 실시하여 VEGF에 의한 chemotaxtic motility에 대한 재조합 PK5의 효과를 조사하였을 때 강력하게 HUVEC의 이동을 억제함을 관찰할 수 있었다(Fig. 2B). 두 assay 방법에서 ICso (최대 저해 효과의 50% 를 나타내는 농도)는 대략 500 nM로 추정되었다.
내피 세포에 PK5 500 nN을 처리한 결과 bFGF에 의해 유도된 ERK1/2의 인산화를 감소시켰다. 또한, PK5는 bFGF에 의해 유도된 내피세포의 골격 재형성을 강력하게 억제하는 것으로 관찰되었다. 따라서, 이러한 결과들은 효모 생산 PK5가 내피세포의 이동을 효과적으로 억제하며, 이는 ERK1/2의 활성과 세포골격의 재배열을 억제함으로써 나타나는 것으로 부분적으로 설명될 수 있다.
영향을 미치는 지 조사하였다. 먼저, wound migration assay에서 bFGF에 의해 유도된 내피세포 이동에 대한 효과를 보았을 때, 정제된 재조합 PK5가 1-1000 nM 농도 범위에서 농도 의존적으로 이동을 억제 하였다(Fig. 2A). 또한 modified Boyden-chamber assay를 실시하여 VEGF에 의한 chemotaxtic motility에 대한 재조합 PK5의 효과를 조사하였을 때 강력하게 HUVEC의 이동을 억제함을 관찰할 수 있었다(Fig.
3). 이러한 결과는 PK5가 내피세포의 이동과 관련된 신호 전달계에 이상을 초래함으로써 내피세포의 이동을 억제하는 것으로 보여 진다.
크기 부분에서 나타났고, 환원 조건에서는 좀 더 느리게 이동함을 관찰하였다. 이황화 결합 파괴에 의한 환원 조건에서 단백질 이동이 느린 것으로 볼 때, 재조합 단백질의 이황화 결합이 유지된 것을 확인할 수 있었다(Fig. IB). 선행연구를 통해서도 구조가 유사한 urokinase kirngle domain 을 효율적으로 Pichia 발현 시스템을 통해 발현하여 보고한 바가 있에 12"kringle 구조가 효모에서 효율적으로 발현됨을 알 수 있다.
메탄올 유도 후 얻은 배양액을 S-spin column을 이용하여 정제하였다. 정제된 단백질을 SDS-PAGE하였을 때 약 10 kDa의 단일 밴드를 나타냄을 확인할 수 있었다. 정제된 PK5는 bFGF나 VEGF에 의해 유도된 인간의 제대 유래 내피 세포의 이동을 약 500 nM의 ICso 값으로 농도 의존적으로 감소시켰다.
site에 in frame으로 클로닝 하였다. 제한효소 Cla I, Xba I 으로 잘랐을 때-삽입 된 DNA가.258bp 크기임을 확인하였고, 염기서열을 조사하였을 때 PK5 서열이 정확함을 확인하였다. SacL으로 자른 재조합 플라스미드를 P.
따라서, 이를 2 1 BMGH 배지에서 배양한 후, 400 ml BMMH 배지로 교환하여 96 시간 동안 메탄올 유도를 실시한 후, 얻은 배양액을 농축하였고, 투석 후 S-spin 컬럼을 이용하여 정제하였다. 최종적으로 정제한 단백 질은 Bicinchoninic acid assay 분석 에 의해 약 26 mg 얻어진 것을 확인하였다(Fig. 1A). SDS-PAGE상에서 Coomassie blue 염색에 의해 확인하였을 때, 한 개의 major 단백질 밴드만 보여 정제 시 비특이 결합에 의한 불순 단백질은 관찰되지 않았고, 비환원 조건에서 이동한 단백질 밴드가 약 10 kDa 예상.
SDS-PAGE상에서 Coomassie blue 염색에 의해 확인하였을 때, 한 개의 major 단백질 밴드만 보여 정제 시 비특이 결합에 의한 불순 단백질은 관찰되지 않았고, 비환원 조건에서 이동한 단백질 밴드가 약 10 kDa 예상.크기 부분에서 나타났고, 환원 조건에서는 좀 더 느리게 이동함을 관찰하였다. 이황화 결합 파괴에 의한 환원 조건에서 단백질 이동이 느린 것으로 볼 때, 재조합 단백질의 이황화 결합이 유지된 것을 확인할 수 있었다(Fig.
후속연구
반면에 angiostatine integrin av&3에 결합하여 내피세포의 이동을 억제하는 것이 관찰된바 있고[28], 다른 독립된 연구에서 ERK1/2 활성을 억제하는 것이 보고되었다[25]. PK5가 어떤 기전에 의해 ERK 인산화를 저해하는지, 그리고 세포 재배열을 억제하는 지는 후속 연구를 통해 밝혀져야 할 것 같다.
세포 이동과 증식에 차별화된 kringle의 활성을 볼 때 이 두 과정에 대한 kringle의 작용점이 다를 것이 예상되므로, 이 두 수용체가 세포 이동에 관여하지 않을 가능성도 있다. 따라서, 본 연구에서 제시한 세포 이동에 대한 PK5의 작용기전에 대한 정보는 PK5의 작용에 대한 이해를 넓히는 데 도움을 줄 것으로 사료된다.
참고문헌 (30)
Cao, Y., A. Chen, S. S. An, R. W. Ji, D. Davidson and M. Llinas. 1997. Kringle 5 of plasminogen is a novel inhibitor of endothelial cell growth. J. Biol. Chem. 272, 22924-22928
Cao, Y., R. W. Ji, D. Davidson, J. Schaller, D. Marti, S. Sohndel, S. G. McCance, M. S. O'Reilliy, M. Llinas, J. Folkman. 1996. Kringle domains of human angiostatin. Characterization of the anti-proliferative activity on endothelial cells. J. BioI. Chem. 271, 29461-29467
Davidson, D. J., C. Haskell, S. Majest, A. Kherzai, D. A. Egan, K. A. Walter, A. Schneider, E. F. Gubbins, L. Solomon, Z. Chen, R. Lesniewski, J. Henkin. 2005. Kringle 5 of human plasminogen induces apoptosis of endothelial and tumor cells through surface-expressed glucose-regulated protein 78. Cancer Res. 65, 4663-4672
Gimbrone, M. A., R. S. Jr. Cotran, S. B. Leapman and J. Folkman. 1974. Tumor growth and neovascularization: an experimental model using the rabbit cornea. J. Natl. Cancer Inst. 52, 413-427
Gonzalez-Gronow, M., T. Kalfa, C. E. Johnson, G. Gawdi and S. V. Pizzo. 2003. The voltage-dependent anion channel is a receptor for plasminogen kringle 5 on human endothelial cells. J. Biol. Chem. 278, 27312-27318
Jaffe, E. A., R. L. Nachman, C. G. Becker and C. K. Minick. 1973. Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic clitelia. J. Clin. Invest. 52, 2745-2756
Ji, W. R., F. J. Castellino, Y. Chang, M. E. Deford, H. Gray, X. Villarreal, M. E Kondli, D. N. Marti, M. Llinas, J. Schaller, R. A. Kramer, and P. A. Trail. 1998. Characterization of kringle domains of angiostatin as antagonists of endothelial cell migration, an important process in angiogenesis. Faseb J. 12, 1731-1738
Ji, W. R., L. G. Barrientos, M. LIinas, H Gray, X. Villarreal, M. E. DeFord, F. J. Castellino, R. A. Kramer, and P. A. Trail. 1998. Selective inhibition by kringle 5 of human plasminogen on endothelial cell migration, an important process in angiogenesis. Biochem. Biophys. Res. Commun. 247, 414-419
Joe, Y. A., Y. K. Hong, D. S. Chung, Y. J. Yang, J. K. Kang, Y. S. Lee, S. I. Chang, W. K. You, H. Lee, and S. I. Chung. 1999. Inhibition of human malignant glioma growth in vivo by human recombinant plasminogen kringles 1-3. Int. J. Cancer 82, 694-699
Kim, K. J., B. Li, J. Winer, M. Armanini, N. Gillett, H. S. Phillips and N. Ferrara. 1993. Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth in vivo. Nature 362, 841-844
Kim, H. K., Hong, Y. K., Park, H. E., Hong, S. H. and Joe, Y. A.. 2003. Secretory production of recombinant urokinase kringle domain in Pichia pastoris. J. Microbiol. Biotechnol. 13, 591-597
Kim, K. S., Hong, Y. K., Joe, Y. A, Lee, Y., Shin, J. Y., Park, H. E., Lee, I. H., Lee, S. Y., Kang, D. K., Chang, S. I., Chung, S. I.. Anti-angiogenic activity of the recombenant kringle domain of urokinase and its specific entry into endothelial cells. 2003. J. Biol. Chem. 278, 11449-11456
Kim, J. S., Yu, H. K, Ahn, J. H., Lee, H. J., Hong, S. W., Jung, K. H., Chang, S. I., Hong, Y. K., Joe, Y. A, Byun, S. M., Lee, S. K., Chung, S. I. and Yoon, Y.. 2004. Human apolopoprotein(a) kringle V inhibits angiogenesis in vitro and in vivo by interfering with the activation of focal adhesion kinases. Biochem. Biophys. Res. Commun. 313, 534-540
Lee, T. H., Rhim, T. and Kim, S. S.. 1998. Prothrombin kringle-2 domain has a growth inhibitory activity against basic fibroblast growth factor-stimulated capillary endothelial cells. J. Biol. Chem. 273, 28805-28812
Magnusson, S., L. Sottrup-Jensen, H. Claeys, M. Zajdel and T. E. Petersen. 1975. Proceedings: Complete primary structure of prothrombin. Partial primary structures of plasminogen and hirudin. Thromb. Diath. Haemorrh. 34, 562-563
McLean, J. W., J. E. Tomlinson, W. J. Kuang, D. L. Eaton, E. Y. Chen, G. M. Fless, A. M. Scanu and R. M. Lawn. 1987. cDNA sequence of human apolipoprotein(a) is homologous to plasminogen. Nature 330, 132-137
Moser, T. L., D. J. Kenan, T. A. Ashley, J. A. Roy, M. D. Goodman, U. K. Misra, D. J. Cheek and S. V. Pizzo. 2001. Endothelial cell surface F1-F10 ATP synthase is active in ATP synthesis and is inhibited by angiostatin. Proc. Natl. Acad. Sci. U. S. A. 98, 6656-6661
Moser, T. L., M. S. Stack, I. Asplin, J. J. Enghild, P. Hojrup, L. Everitt, S. Hubchak, H. W. Schnaper, S. V. Pizzo. 1999. Angiostatin binds ATP synthase on the surface of human endothelial cells. Proc. Natl. Acad. Sci. U. S. A. 96, 2811-2816
O'Reilly, M. S., L. Holmgren, Y. Shing, C. Chen, R. A. Rosenthal, M. Moses, W. S. Lane, Y. Cao, E. H. Sage, J. Folkman. 1994. Angiostatin: a novel angiogenesis inhibitor that mediates the suppression of metastases by a Lewis lung carcinoma. Cell 79, 315-328
O'Reilly, M. S., T. Boehm, Y. Shing, N. Fukai, G. Vasios, W.S. Lane, E. Flynn, J. R. Birkhead, B. R. Olsen, J. Folkman. 1997. Endostatin: an endogenous inhibitor of angiogenesis and tumor growth. Cell 88, 277-285
Parangi, S., M. S. O'Reilly, G. Christofori, L. Holmgren, J. Grosfeld, J. Folkman and D. Hanahan. 1996. Antiangiogenic therapy of transgenic mice impairs de novo tumor growth. Proc. Natl. Acad. Sci. U. S. A. 93, 2002-2007
Pennica, D., W. E. Holmes, W. J. Kohr, R. N. Harkins, G. A. Vehar, C. A. Ward, W. F. Bennett, E. Yelverton, P. H. Seeburg, H. L. Heyneker, D. A. Goeddel, D. Collen. 1983. Cloning and expression of human tissue-type plasminogen activator cDNA in E. coli. Nature 301, 214-221
Redlitz, A., G. Daum, E. H. Sage. 1998. Angiostatin diminishes activation of the mitogen-activated protein kinases ERK-1 and ERK-2 in human dermal microvascular endothelial cells. J. Vase. Res. 36, 28-34
Rousseau, S., F. Houle and J. Hout. Integrating the VEGF signals leading to antin-based motility in vascular endothelial cells. 2000. Trends Cardiovasc Med. 10, 321-327
Steffens, G. J., W.A. Gunzler, F. Otting, E. Frankus and L. Flohe. 1982. The complete amino acid sequence of low molecular mass urokinase from human urine. Hoppe Seylers Z. Physiol. Chem. 363, 1043-1058
Tarui, T., M. Majumdar, L. A. Miles, W. Ruf and Y. Takada. 2002. Plasmin-induced migration of endothelial cells. A potential target for the anti-angiogenic action of angiostatin. J. Biol. Chem. 277, 33564-33570
Tournaire, R., M. R Simon, F. I. noble, A. Eichmann, P. England and J. Pouyssegur. A short synthetic peptide inhibits signal transduction, migration and angiogenesis mediated by Tie2 receptor. 2004. EMBO Reports 5, 262-267
Troyanovsky, B., T. Levchenko, G. Mansson, O. Matvijenko and L. Holmgren. 2001. Angiomotin: an angiostatin binding protein that regulates endothelial cell migration and tube formation. J. Cell. Biol. 152, 1247-1254
※ AI-Helper는 부적절한 답변을 할 수 있습니다.