Bacillusvelezensis CC112 균주는 인삼 잘록병을 일으키는 Rhizoctonia solani를 비롯한 여러 식물병원균의 균사 생장을 억제하였다. 인삼 잘록병균 R. solani에 대하여 B. velezensis CC112 균주를 Luria-Bertani (LB)와 Bacillus-soytone medium 배지에 배양한 10배 희석액의 종자침지처리와 LB 배지에 배양한 10배 희석액을 토양관주처리하여 65.8%, 67.1%와 64.2% 방제효과를 나타냈다. B.velezensis CC112 균주의 시제품을 100배로 희석하여 토양관주처리하여 R. solani에 77.3%, Pythium sp.에 65.7% 방제효과를 각각 나타내었다. 이들 결과에서 B. velezensis CC112 균주는 인삼 잘록병의 방제에 유망한 미생물살균제가 될 수 있다.
Bacillusvelezensis CC112 균주는 인삼 잘록병을 일으키는 Rhizoctonia solani를 비롯한 여러 식물병원균의 균사 생장을 억제하였다. 인삼 잘록병균 R. solani에 대하여 B. velezensis CC112 균주를 Luria-Bertani (LB)와 Bacillus-soytone medium 배지에 배양한 10배 희석액의 종자침지처리와 LB 배지에 배양한 10배 희석액을 토양관주처리하여 65.8%, 67.1%와 64.2% 방제효과를 나타냈다. B.velezensis CC112 균주의 시제품을 100배로 희석하여 토양관주처리하여 R. solani에 77.3%, Pythium sp.에 65.7% 방제효과를 각각 나타내었다. 이들 결과에서 B. velezensis CC112 균주는 인삼 잘록병의 방제에 유망한 미생물살균제가 될 수 있다.
Bacillus velezensis CC112 inhibited the mycelial growth of several plant pathogens, including Rhizoctonia solani, causing damping-off on ginseng. The control efficacies of B. velezensis CC112 against R. solani by seed dipping in LB and BSM broth diluted 10 times, soil dipping, and soil drenching wit...
Bacillus velezensis CC112 inhibited the mycelial growth of several plant pathogens, including Rhizoctonia solani, causing damping-off on ginseng. The control efficacies of B. velezensis CC112 against R. solani by seed dipping in LB and BSM broth diluted 10 times, soil dipping, and soil drenching with LB broth diluted 10 times were 65.8%, 67.1%, and 64.2%, respectively. Treatment of soil drenching with the 100 times diluted prototype of B. velezensis CC112 against R. solani and Pythium sp. by soil revealed control efficacies of 77.3% and 65.7%, respectively. These results indicate that B. velezensis CC112 is a prospective biofungicide for the biological control of ginseng damping off.
Bacillus velezensis CC112 inhibited the mycelial growth of several plant pathogens, including Rhizoctonia solani, causing damping-off on ginseng. The control efficacies of B. velezensis CC112 against R. solani by seed dipping in LB and BSM broth diluted 10 times, soil dipping, and soil drenching with LB broth diluted 10 times were 65.8%, 67.1%, and 64.2%, respectively. Treatment of soil drenching with the 100 times diluted prototype of B. velezensis CC112 against R. solani and Pythium sp. by soil revealed control efficacies of 77.3% and 65.7%, respectively. These results indicate that B. velezensis CC112 is a prospective biofungicide for the biological control of ginseng damping off.
* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.
문제 정의
따라서 본 연구에서는 환경친화적 안전한 인삼을 생산하기 위하여 선발한 Bacillus velezensis CC112 균주가 인삼모에 발생하는 잘록병균의 생육억제 효과와 인삼 잘록병에 대한 방제 효과 검정을 실시하였다.
제안 방법
Genomic DNA는 Genomic Plus DNA Prep kit (Inclone, Yongin, Korea)를 이용하여 추출하였다. 16S rRNA 유전자의 증폭을 위해 범용 프라이머인 27F와 1492R을 사용하였고, gyrB 유전자의 증폭을 위해 범용 프라이머인 UP-1과 UP-2r을 사용하여 PCR한 후 각각 유전자의 증폭산물을 얻었다[19, 20]. 3개의 프라이머(518F; CCAGCAGCCGCGGTAATACG, 800R; TACCAGGGTATCTAATCC, 984F; ACGCGARGAACCTTAC)를 이용하여 16S rRNA 유전자의 염기서열을 이용하고 gyrB 유전자는 두 개의 염기서열 분석용 프라이머(UP-1S; GAA GTC ATC ATG ACC GTT CTG CA, UP-2Sr; AGC AGG GTA CGG ATG TGC GAG CC)를 이용하여 분석하도록 제노텍(GenoTech, Daejeon, Korea)에 의뢰하였다.
16S rRNA와 gyrB 유전자를 바탕으로 MEGA5 프로그램을 이용하여 분자유전학적인 계통도를 작성하고 선발 균주의 분류학적 위치를 확인하였다(Fig. 2). 16S rRNA 유전자를 바탕으로 작성한 계통도에서 CC112 균주는 Bacillus velez 2Aensis BCRC 17467(T) 및 B.
16S rRNA 유전자의 증폭을 위해 범용 프라이머인 27F와 1492R을 사용하였고, gyrB 유전자의 증폭을 위해 범용 프라이머인 UP-1과 UP-2r을 사용하여 PCR한 후 각각 유전자의 증폭산물을 얻었다[19, 20]. 3개의 프라이머(518F; CCAGCAGCCGCGGTAATACG, 800R; TACCAGGGTATCTAATCC, 984F; ACGCGARGAACCTTAC)를 이용하여 16S rRNA 유전자의 염기서열을 이용하고 gyrB 유전자는 두 개의 염기서열 분석용 프라이머(UP-1S; GAA GTC ATC ATG ACC GTT CTG CA, UP-2Sr; AGC AGG GTA CGG ATG TGC GAG CC)를 이용하여 분석하도록 제노텍(GenoTech, Daejeon, Korea)에 의뢰하였다. 얻어진 염기서열은 SeqMan (DNASTAR, Madison, WI, USA)을 이용하여 직접 오류를 검정하고 연결하였다.
균주는 25℃, Sclerotium cepivorum, Sclerotinia sclerotiorum, Botrytis cinerea 균주는 20℃에서 각각 5~7일간 배양하여 직경 5 mm 코르크보러를 이용하여 병원균의 균총을 PDA 배지가 분주된 일회용 페트리디쉬 중앙에 치상하였다. CC112 균주는 TSA 평판배지에 배양하여 루프를 이용하여 방선균을 떼어내어 PDA 배지가 분주된 일회용 페트리디쉬에 3개소에 치상하여 병원균별로 25℃와 20℃ 항온기에서 7~10일간 배양 후 저지원의 직경을 조사하였다.
CC112 균주는 TSB (Difco, Detroit, MI, USA)에 접종하여 30℃에서 24시간 이상 배양한 후 원심분리하여 균체를 수확하였다. Genomic DNA는 Genomic Plus DNA Prep kit (Inclone, Yongin, Korea)를 이용하여 추출하였다. 16S rRNA 유전자의 증폭을 위해 범용 프라이머인 27F와 1492R을 사용하였고, gyrB 유전자의 증폭을 위해 범용 프라이머인 UP-1과 UP-2r을 사용하여 PCR한 후 각각 유전자의 증폭산물을 얻었다[19, 20].
얻어진 염기서열은 SeqMan (DNASTAR, Madison, WI, USA)을 이용하여 직접 오류를 검정하고 연결하였다. 각 유전자의 비교분석을 위해서 16S rRNA 유전자의 염기서열 및 균주간 상동성은 EzTaxon (http://www.ezbiocloud.net/eztaxon)을 통해서 얻었으며[21], gyrB 유전자의 염기서열은 GenBank (www.ncbi.nlm.nih/genbank)를 통하여 얻었다. 계통도의 작성을 위해 MEGA 5.
nih/genbank)를 통하여 얻었다. 계통도의 작성을 위해 MEGA 5.0 프로그램의 Clustal W 프로그램으로 염기서열을 정렬하고 염기서열 길이를 맞추었다. 계통도를 작성하기 위해 neighbor-joining 알고리즘을 사용하였으며, 계통도의 신뢰성을 확보하기 위해 1,000회 반복 bootstrapping을 수행하였다[22].
Phytophthpora sp. 균주는 25℃, Sclerotium cepivorum, Sclerotinia sclerotiorum, Botrytis cinerea 균주는 20℃에서 각각 5~7일간 배양하여 직경 5 mm 코르크보러를 이용하여 병원균의 균총을 PDA 배지가 분주된 일회용 페트리디쉬 중앙에 치상하였다. CC112 균주는 TSA 평판배지에 배양하여 루프를 이용하여 방선균을 떼어내어 PDA 배지가 분주된 일회용 페트리디쉬에 3개소에 치상하여 병원균별로 25℃와 20℃ 항온기에서 7~10일간 배양 후 저지원의 직경을 조사하였다.
solani와 Pythium sp. 균주를 각각 배양한 보리를 상자당 0.5 g/상자 접종하였고, 최종 6회 처리 7일 후 이병주를 조사하였다.
solani와 Pythium sp. 균총을 직경 5 mm 코르크보러를 이용하여 병원균의 균총을 PDA 배지가 분주된 I 플레이트에 치상하여 25℃에서 5일간 배양하여 조사하였다.
종자침지처리는 CC112균주의 LB, KB, BSM 배지에 28℃에서 2일간 180 rpm으로 진탕배양한 각각의 배양액을 10배 희석하여 인삼 개각 종자를 1시간 침지한 후 파종하였다. 그리고 관주처리는 인삼 개각종자를 침지처리하여 파종한 다음 균주별 배양액을 10배로 희석하여 주당 10 mL씩 7일 간격 6회 관주처리하였다. 모든 처리에서 3반복으로 하였으며, 병원균의 접종은 병원균 R.
종자 침지처리구는 시제품을 50배와 100배로 각각 희석하여 개각종자를 1시간 침지하여 상자에 파종하였다. 또한 관주처리구는 인삼 개각종자를 상자에 파종한 다음 시제품을 50배와 100배로 각각 희석하여 주당 10 mL씩 처리하였고, 7일 간격 3회 토양에 관주처리하였다. 병원균의 접종은 병원균을 각각 배양한 보리를 종자 파종 12일 후에 상자당 8개씩 접종하였다.
또한 관주처리구는 인삼 개각종자를 상자에 파종한 다음 시제품을 50배와 100배로 각각 희석하여 주당 10 mL씩 처리하였고, 7일 간격 3회 토양에 관주처리하였다. 병원균의 접종은 병원균을 각각 배양한 보리를 종자 파종 12일 후에 상자당 8개씩 접종하였다. 인삼종자의 발아율은 파종 20일후 조사하였으며, 인삼 잘록병 발생은 파종 40일 후에 이 병주를 조사하였다.
3개의 프라이머(518F; CCAGCAGCCGCGGTAATACG, 800R; TACCAGGGTATCTAATCC, 984F; ACGCGARGAACCTTAC)를 이용하여 16S rRNA 유전자의 염기서열을 이용하고 gyrB 유전자는 두 개의 염기서열 분석용 프라이머(UP-1S; GAA GTC ATC ATG ACC GTT CTG CA, UP-2Sr; AGC AGG GTA CGG ATG TGC GAG CC)를 이용하여 분석하도록 제노텍(GenoTech, Daejeon, Korea)에 의뢰하였다. 얻어진 염기서열은 SeqMan (DNASTAR, Madison, WI, USA)을 이용하여 직접 오류를 검정하고 연결하였다. 각 유전자의 비교분석을 위해서 16S rRNA 유전자의 염기서열 및 균주간 상동성은 EzTaxon (http://www.
선발균주의 동정을 위해 일반적으로 사용되는 16S rRNA 유전자의 염기서열을 사용하였으며, 추가로 Bacillus spp.의 분류에 유용한 것으로 알려진 DNA gyrase유전자(gyrB 유전자)의 염기서열을 이용하여 선발균주의 분류학적 위치를 분석하였다[18]. CC112 균주는 TSB (Difco, Detroit, MI, USA)에 접종하여 30℃에서 24시간 이상 배양한 후 원심분리하여 균체를 수확하였다.
병원균의 접종은 병원균을 각각 배양한 보리를 종자 파종 12일 후에 상자당 8개씩 접종하였다. 인삼종자의 발아율은 파종 20일후 조사하였으며, 인삼 잘록병 발생은 파종 40일 후에 이 병주를 조사하였다.
2 × 107/g로 제조한 시제품을 충남대학교로부터 받아서 실험하였다. 종자 침지처리구는 시제품을 50배와 100배로 각각 희석하여 개각종자를 1시간 침지하여 상자에 파종하였다. 또한 관주처리구는 인삼 개각종자를 상자에 파종한 다음 시제품을 50배와 100배로 각각 희석하여 주당 10 mL씩 처리하였고, 7일 간격 3회 토양에 관주처리하였다.
종자침지처리는 CC112균주의 LB, KB, BSM 배지에 28℃에서 2일간 180 rpm으로 진탕배양한 각각의 배양액을 10배 희석하여 인삼 개각 종자를 1시간 침지한 후 파종하였다. 그리고 관주처리는 인삼 개각종자를 침지처리하여 파종한 다음 균주별 배양액을 10배로 희석하여 주당 10 mL씩 7일 간격 6회 관주처리하였다.
대상 데이터
Bacillus velezensis CC112 균주는 춘천의 토마토 근권토양에서 분리하여 trypticase soy agar (TSA, Bacto Tryptone 15 g, Bacto Soytone 5 g, NaCl 5 g, agar 15 g/L) 배지에서 28℃에서 2일간 배양한 후 균체를 멸균한 글리세롤 20%액에 넣고 -20℃에 보관하면서 계대 배양하여 사용하였으며, 국립농업과학원에 기탁하여 KACC92129P 수탁번호를 받았다
Bacillus velezensis CC112 균주를 Luria-Bertani (LB, tryptone 10 g, yeast extract 5 g, NaCl 10 g), trypticase soy broth (TSB, Bacto Tryptone 15 g, Bacto Soytone 5 g, NaCl 5 g), King's B agar (KB, Peptone 20 g, K2HPO4 1.5 g, MgSO4·7H2O 1.5 g, Glycerol 15 ml), Bacillus-soytone medium (BSM, Soytone 0.5%, Sucrose 2%) 사용하여 각각의 배지에 미리 배양한 균주를 2% (v/v)으로 접종하여 25℃, 180 rpm으로 조절한 진탕배양기에서 48시간 후 배양액을 사용하였다.
CC112균주 시제품은 벤토나이트를 증량제로 사용하여 9.2 × 107/g로 제조한 시제품을 충남대학교로부터 받아서 실험하였다.
데이터처리
a)In a column, means followed by a common letter are not significantly different at the 5% level by Duncan’s multiple range test.
이론/모형
0 프로그램의 Clustal W 프로그램으로 염기서열을 정렬하고 염기서열 길이를 맞추었다. 계통도를 작성하기 위해 neighbor-joining 알고리즘을 사용하였으며, 계통도의 신뢰성을 확보하기 위해 1,000회 반복 bootstrapping을 수행하였다[22].
성능/효과
2). 16S rRNA 유전자를 바탕으로 작성한 계통도에서 CC112 균주는 Bacillus velez 2Aensis BCRC 17467(T) 및 B. methylotrophicus KACC 13105(T) 균주와 높은 상동성(100%)을 보였다(Fig. 2A). 계통도의 신뢰성을 확보하기 위한 bootstrap 값도 89%로 비교적 높은 값을 보였다.
Bacillusvelezensis CC112 균주는 인삼 잘록병을 일으키는 Rhizoctonia solani를 비롯한 여러 식물병원균의 균사 생장을 억제하였다. 인삼 잘록병균 R.
stearothermophilus를 이용하여 탈크, 제오라이트, 벤토나이트, 벤토나이트+탈크, 탈크+제오라이트, 벤토나이트+제오라이트 제제를 만들어서 오이 잘록병균(Pythium aphanidermatum)이 처리된 상토 혼화처리한 결과에서 탈크, 제오라이트, 벤토나이트 각각의 단제는 45~55%, 두 보조제를 혼합한 벤토나이트+탈크, 탈크+제오라이트, 벤토나이트+제오라이트 제제는 단제보다 높은 58~70%의 방제효과를 나타내었으며, 화학살균제와 비교시에도 비슷한 방제 효과를 나타내었다고 하였다. CC112 균주의 벤토나이트 제품과 비교하면 토양관주 100배액 처리가 77.3%로 나타나 B. stearothermophilus 균주보다 높은 방제 효과를 보여서 제품으로 개발 가능성을 보여주었다. 그리고 미생물제품 Serenade (B.
CC112균주의 시제품을 50배와 100배로 각각 희석하여 R. solani에 대하여 처리한 결과, 토양관주가 종자침지처리보다 방제효과가 높으며, 50배액 종자의 침지처리가 30.7%, 100배액의 종자침지가 47.2%로 낮은 방제효과를 보였으나, 토양관주처리한 구에서 50배 희석액은 52.3%와 100배 희석액은 77.3% 방제효과를 나타냈다(Table 3, Fig. 3).
LB, KB와 BSM 배지에서 배양한 CC112 균주의 배양액을 10배로 희석하여 종자침지처리와 종자침지+토양관주처리한 결과는 LB 배지와 BSM 배지의 배양액이 KB 배지 배양액보다 방제 효과가 높았다. 종자 침지처리 경우에는 LB 배지가 65.
amyloliquefaciens subsp. plantarum 균주에 높은 상동성(100%)을 보였으며, 99%의 Bootstrap 값을 보이며 높은 계통도의 신뢰성을 보였다(Fig. 2B). 최근 계통유전체학을 바탕으로 한 Bacillus spp.
2A). 계통도의 신뢰성을 확보하기 위한 bootstrap 값도 89%로 비교적 높은 값을 보였다. CC112 균주는 gyrB 유전자를 바탕으로 작성한 계통도에서 B.
velezensis로 분류되어야 한다고 보고되었다[23]. 본 연구의 선발 균주인 CC112 균주는 16S rRNA 유전자와 gyrB 유전자를 이용하여 분석한 결과 Dunlap 등[23]의 보고에 따라 B. velezensis로 동정되었다.
solani와 Pythium sp.에 대하여 CC112 균주의 시제품은 종자침지보다는 토양관주처리가 효과적이었으며, 100배액 관주처리가 50배액 관주처리보다 높은 65.7~77.3% 방제하였다.
Pythium sp.에 대해서도 R. solani에 대하여 처리 결과와 같이 토양관주가 종자침지처리보다 방제효과가 높다. 종자 침지처리구가 38.
7% 방제효과를 각각 나타내었다(Table 2). 이 결과를 분석하면 종자를 파종할 때 1회 침지처리만 한 구가 종자침지 1회와 토양관주 6회 처리한 구보다도 종자침지처리구가 방제 효율이 높은 것으로 나타났다.
7% 방제효과를 각각 나타내었다. 이들 결과에서 B. velezensis CC112 균주는 인삼 잘록병의 방제에 유망한 미생물살균제가 될 수 있다.
Bacillusvelezensis CC112 균주는 인삼 잘록병을 일으키는 Rhizoctonia solani를 비롯한 여러 식물병원균의 균사 생장을 억제하였다. 인삼 잘록병균 R. solani에 대하여 B. velezensis CC112 균주를 Luria-Bertani (LB)와 Bacillus-soytone medium 배지에 배양한 10배 희석액의 종자침지처리와 LB 배지에 배양한 10배 희석액을 토양관주처리하여 65.8%, 67.1%와 64.2% 방제효과를 나타냈다. B.
LB, KB와 BSM 배지에서 배양한 CC112 균주의 배양액을 10배로 희석하여 종자침지처리와 종자침지+토양관주처리한 결과는 LB 배지와 BSM 배지의 배양액이 KB 배지 배양액보다 방제 효과가 높았다. 종자 침지처리 경우에는 LB 배지가 65.8%, KB 배지는 26.7%, BSM 배지는 67.1%, 종자 침지와 토양관주를 같이 처리하였을 때 LB 배지가 64.2%, KB배지가 24.4%, BSM 배지가 53.7% 방제효과를 각각 나타내었다(Table 2). 이 결과를 분석하면 종자를 파종할 때 1회 침지처리만 한 구가 종자침지 1회와 토양관주 6회 처리한 구보다도 종자침지처리구가 방제 효율이 높은 것으로 나타났다.
solani에 대하여 처리 결과와 같이 토양관주가 종자침지처리보다 방제효과가 높다. 종자 침지처리구가 38.3~39.1% 방제효과를 보인 반면에 토양관주 50배 처리가 56.5%, 토양관주 100배처리가 65.7%의 방제효과를 나타냈다(Table 4, Fig. 4).
후속연구
의 균사 생육 억제 효과를 조사한 결과에서는 잘록병균에 대하여 억제 효과는 없었다. B. velezensis CC112 균주가 R. solani 등 여러 식물병원균에 대하여 항균활성을 나타낸 것은 식물병 방제와 관련이 있는 바실러스 균주의 이차대사산물 중 cyclic lipopeptides (bacillomycin D, fengycin, iturin, surfactin), a dipeptide (bacilysin), siderophore (bacillibactin), polyketides (bacillaene, difficidin, and macrolactin) 등이 생합성 관련 유전자를 보유하고 있는 것[17]으로 추정되며 이를 확인하기 위하여 유전체 분석이 필요하다.
이와 같이 CC112 균주는 Rhizoctonia solani와 Pythium sp.에 대하여 항균활성이 있어서 방제가 곤란한 토양병해 인삼 잘록병에 방제 효과를 나타내어 화학농약을 대체할 수 있는 친환경 인삼 잘록병 방제제로서 개발할 필요가 있다고 생각된다.
질의응답
핵심어
질문
논문에서 추출한 답변
잘록병 방제제 개발에 대한 선행 연구 사례는 무엇이 있는가?
잘록병에 대한 생물적 방제 연구는 Bacillus spp, Trichoderma spp., Gliocladium spp., Pseudomonas spp. 등이 이용되었으며[10-12], 국내에서는 Kim 등[13]과 Joo 등[14]이 Bacillus ehimensis를 분리하여 R. solani AG-4와 P. ultimum 에 의한 채소류의 모잘록병, Yang 등[15]은 Bacillus stearothermophilus를 이용하여 여러 제제로 제조하여 오이 잘록병균 Pythium aphanidermatum에 처리하여 화학 살균제와 비슷한 방제 효과를 나타내어 개발 가능성을 보여주었다. Jo 등[16]은 미국의 AgraQuest사가 개발한 Serenade (Bacillus subtilis QST713) 제품을 고추와 오이의 R. solani와 P. ultimum에 대한 방제 효과를 검토한 바 있다.
인삼 잘록병의 발생 원인은?
우리나라의 인삼에 발생하는 잘록병의 병원균은 Rhizoctonia solani, Pythium ultimum, Pythium debaryanum이 보고되어 있다[1]. 인삼 잘록병은 묘삼생산에 직결되는 가장 중요한 토양병으로 과도한 짚 멀칭 등으로 토양습도가 높고 서늘하면서 다비, 밀식 재배환경에서 갑자기 집단적으로 발생한다[2]. 인삼에서 R.
인삼에서 R. solani에 의한 잘록병의 발생 시기는?
인삼에서 R. solani에 의한 잘록병은 4월 중하순에 시작하여 5월 상순에 발생하며 땅에 접한 줄기부위가 암갈색으로 마르면서 쓰러진다. Pythium ultimum에 의한 잘록병은 5월 하순 이후 발생하고 줄기부위가 흐물거리며 물러 썩는 증상으로 나타난다고 하였다[3].
참고문헌 (23)
The Korean Society of Plant Pathology. List of plant diseases in Korea. 5th ed. Seoul: Korean Society of Plant Pathology; 2009.
Rahman M, Punja ZK. Biological control of damping-off an American ginseng (Panax quinquefolius) by Clonostachys rosea f. catenulate ( Gliocladium catenulatum). Can J Plant Pathol 2007;29:203-7.
Cho DH, Cho HS, Shin JS, Park DW. Control of damping-off and ginseng stem fungus gnat of ginseng. In: KT&G Ginseng re- search report. 2007. p. 28-33.
Hong SK. Survey of ginseng cultivation in Southern Korea. So-yeun (Central Monopoly Institute) 1964;6:27-44.
Yu YH, Cho DH, Ohh SH. Effect of tolclofos-methyl on damping- off of ginseng seedlings incited by Rhizoctonia solani. Korean J Ginseng Sci 1989;13:114-8.
Georgakopoulos DG, Fiddaman P, Leifert C, Malathrakis NE. Biological control of cucumber and sugar beet damping off caused by Pythium ultimum with bacterial and fungal antagonists. J Appl Microbiol 2002;92:1078-86.
Howell CR, Stipanovic, RD. Suppression of Pythium ultimuminduced damping-off of cotton seedlings by Pseudomonas fluorescens and its antibiotic, pyoluteorin. Phytopathology 1980; 70:712-5.
Zamanizadeh HR, Hatami N, Aminaee MM, Rakhshandehroo F. Application of biofungicides in control of damping disease off in greenhouse crops as a possible substitute to synthetic fungicides. Int J Environ Sci Technol (Tehran) 2011;8:129-36.
Joo GJ, Kim JH, Kang SJ. Isolation and antifungal activity of Bacillus ehimensis YJ-37 as antagonistic against vegetables damping- off fungi. Korean J Life Sci 2002;12:200-7.
Jo EJ, Kang BG, Jang KS, Choi YH, Kim JC, Choi GJ. Control efficacy of Serenade formulation against Rhizoctonia and Pythium damping-off diseases. Res Plant Dis 2014;20:201-5.
Lee SY, Kim BY, Ahn JH, Song J, Seol YJ, Kim WG, Weon HY. Draft genome sequence of the biocontrol bacterium Bacillus amyloliquefaciens strain M27. J Bacteriol 2012;194:6934-5.
Wang LT, Lee FL, Tai CJ, Kasai H. Comparison of gyrB gene sequences, 16s rRNA gene sequences and DNA-DNA hybridization in the Bacillus subtilis group. Int J Syst Evol Microbiol 2007;57:1846-50.
Yamamoto S, Harayama S. PCR amplification and direct sequencing of gyrB genes with universal primers and their application to the detection and taxonomic analysis of Pseudomonas putida strains. Appl Environ Microbiol 1995;61:1104-9.
Song J, Lee SC, Kang JW, Baek HJ, Suh JW. Phylogenetic analysis of Streptomyces spp. isolated from potato scab lesions in Korea on the basis of 16s rRNA gene and 16s-23s rDNA internally transcribed spacer sequences. Int J Syst Evol Microbiol 2004;54:203-9.
Lee SY, Kim BY, Ahn JH, Song J, Seol YJ, Kim WG, Weon HY. Draft genome sequence of the biocontrol bacterium Bacillus amyloliquefaciens strain M27. J Bacteriol 2012;194:6934-5.
Wang LT, Lee FL, Tai CJ, Kasai H. Comparison of gyrB gene sequences, 16s rRNA gene sequences and DNA-DNA hybridization in the Bacillus subtilis group. Int J Syst Evol Microbiol 2007;57:1846-50.
Yamamoto S, Harayama S. PCR amplification and direct sequencing of gyrB genes with universal primers and their application to the detection and taxonomic analysis of Pseudomonas putida strains. Appl Environ Microbiol 1995;61:1104-9.
Song J, Lee SC, Kang JW, Baek HJ, Suh JW. Phylogenetic analysis of Streptomyces spp. isolated from potato scab lesions in Korea on the basis of 16s rRNA gene and 16s-23s rDNA internally transcribed spacer sequences. Int J Syst Evol Microbiol 2004;54:203-9.
Kim OS, Cho YJ, Lee K, Yoon SH, Kim M, Na H, Park SC, Jeon YS, Lee JH, Yi H, et al. Introducing EzTaxon-e: a prokaryotic 16S rRNA gene sequence database with phylotypes that represent uncultured species. Int J Syst Evol Microbiol 2012;62:716-21.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011;28:2731-9.
Dunlap CA, Kim SJ, Kwon SW, Rooney AP. Bacillus velezensis is not a later heterotypic synonym of Bacillus amyloliquefaciens; Bacillus methylotrophicus, Bacillus amyloliquefaciens subsp. plantarum and 'Bacillus oryzicola' are later heterotypic synonyms of Bacillus velezensis based on phylogenomics. Int J Syst Evol Microbiol 2016;66:1212-7.
※ AI-Helper는 부적절한 답변을 할 수 있습니다.