[논문]Innate Color Preference of Zebrafish and Its Use in Behavioral Analyses

Park, Jong-Su; Ryu, Jae-Ho; Choi, Tae-Ik; Bae, Young-Ki; Lee, Suman; Kang, Hae Jin; Kim, Cheol-Hee

doi:10.14348/molcells.2016.0173

Innate Color Preference of Zebrafish and Its Use in Behavioral Analyses 원문보기

Molecules and cells, v.39 no.10, 2016년, pp.750 - 755

Park, Jong-Su (Department of Biology, Chungnam National University) , Ryu, Jae-Ho (Department of Biology, Chungnam National University) , Choi, Tae-Ik (Department of Biology, Chungnam National University) , Bae, Young-Ki (Comparative Biomedicine Research Branch, National Cancer Center) , Lee, Suman (Division of Structural and Functional Genomics, Center for Genome Science, National Research Institute of Health) , Kang, Hae Jin (Department of Biology, Chungnam National University) , Kim, Cheol-Hee (Department of Biology, Chungnam National University)

Abstract ▼ AI-Helper

Although innate color preference of motile organisms may provide clues to behavioral biases, it has remained a longstanding question. In this study, we investigated innate color preference of zebrafish larvae. A cross maze with different color sleeves around each arm was used for the color preference test (R; red, G; green, B; blue, Y; yellow). The findings showed that 5 dpf zebrafish larvae preferred blue over other colors (B > R > G > Y). To study innate color recognition further, tyrosinase mutants were generated using CRISPR/Cas9 system. As a model for oculocutaneous albinism (OCA) and color vision impairment, tyrosinase mutants demonstrated diminished color sensation, indicated mainly by hypopigmentation of the retinal pigment epithelium (RPE). Due to its relative simplicity and ease, color preference screening using zebrafish larvae is suitable for high-throughput screening applications. This system may potentially be applied to the analysis of drug effects on larval behavior or the detection of sensory deficits in neurological disorder models, such as autism-related disorders, using mutant larvae generated by the CRISPR/Cas9 technique.

주제어

AI 본문요약
AI-Helper

* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.

문제 정의

, 2012). This study examined innate color preference using zebrafish larvae. Such investigations involving innate color recognition and response should be designed to avoid postnatal adaptation and address the subtle responses to monochromatic light in daytime (Sugimoto et al.

제안 방법

In this study, a simple color preference test in zebrafish was established, and using CRISPR/Cas9, a zebrafish OCA model which has hypopigmented RPE resulting in color blindness was generated. Color sensation of zebrafish is very unique, and especially B over Y color recognition is distinctive enough to be applied to various genetic and pharmaceutical studies (Supplementary Fig.

대상 데이터

All maze experiments were recorded using a high-resolution digital camera (HDR-CX130, Sony, Japan). The video file was first stored on the camera’s memory card and subsequently transferred to the computer’s hard drive.
3 and 6A). The maze was built using 3mm clear acrylic sheets. The cross maze had four arms, and the bidirectional color maze had two arms in a transparent acryl plate.
tyrosinase (ENSDARG00000039077) target sites of Cas9 were identified using the ZiFiT Targeter (http://zifit. partners.org/ ZiFiT/) and selected oligonucleotides were cloned into pDR274 (Addgene) linearized with Bsa I (BioLabs). The templates for in vitro transcription of sgRNAs were produced by PCR using primers 5’ TAGGACTGGAGGACTTCTGGGG 3’ (oligo #1) and 5’ AAACCCCCAGAAGTCCTCCAGT 3’ (oligo #2).

데이터처리

All data and graphs were expressed as mean ± standard error of the mean (SEM) and analyzed by an independent t-test using the statistics program (SPSS, IBM, USA).

참고문헌 (22)

Avdesh A. Martin-Iverson M.T. Mondal A. Chen M. Askraba S. Morgan N. Lardelli M. Groth D.M. Verdile G. Martins R.N. 2012 Evaluation of color preference in zebrafish for learning and memory J. Alzheimers. Dis. 28 459 469 22008261
Bowmaker J.K. 2008 Evolution of vertebrate visual pigments Vision Res. 48 2022 2041 18590925
Fadool J.M. Dowling J.E. 2008 Zebrafish: a model system for the study of eye genetics Prog. Retin. Eye Res. 27 89 110 17962065

상세보기
Gerkema M.P. Davies W.I.L. Foster R.G. Menaker M. Hut R.a. 2013 The nocturnal bottleneck and the evolution of activity patterns in mammals Proc. Biol. Sci. 280 20130508 23825205

상세보기
Glass A.S. Dahm R. 2004 The zebrafish as a model organism for eye development Ophthalmic Res. 36 4 24 15007235
Goldsmith P. Harris W.A. 2003 The zebrafish as a tool for understanding the biology of visual disorders Semin. Cell Dev. Biol. 14 11 18 12524002

상세보기
Grønskov K. Ek J. Brondum-Nielsen K. 2007 Oculocutaneous albinism Orphanet J. Rare Dis. 2 43 17980020

상세보기
Jacobs G.H. 2009 Evolution of colour vision in mammals Philos. Trans. R. Soc. Lond. B. Biol. Sci. 364 2957 2967 19720656
Joselevitch C. Kamermans M. 2009 Retinal parallel pathways: Seeing with our inner fish Vision Res. 49 943 959 18722397
Lee S.H. Lee M.S. Choi T.I. Hong H. Seo J.Y. Kim C.H. Kim J. 2016 MCRS1 associates with cytoplasmic dynein and mediates pericentrosomal material recruitment Sci. Rep. 6 27284 27263857

상세보기
Liu N. Kong X.D. Shi H.R. Wu Q.H. Jiang M. 2014 Tyrosinase gene mutations in the Chinese Han population with OCA1 Genet. Res. (Camb). 96 e14 25577957
LoBue V. DeLoache J.S. 2011 Pretty in pink: The early development of gender-stereotyped colour preferences Br. J. Dev. Psychol. 29 656 667 21848751

상세보기
May M. Hwang K.-S. Miles J. Williams C. Niranjan T. Kahler S.G. Chiurazzi P. Steindl K. Van P.J. Spek D. 2015 ZC4H2, an XLID gene, is required for the generation of a specific subset of CNS interneurons Hum. Mol. Genet. 24 4848 4861 26056227

상세보기
Miller A.C. Voelker L.H. Shah A.N. Moens C.B. 2015 Neurobeachin is required postsynaptically for electrical and chemical synapse formation Curr. Biol. 25 16 28 25484298

상세보기
Nawrocki L. BreMiller R. Streisinger G. Kaplan M. 1985 Larval and adult visual pigments of the zebrafish, Brachydanio rerio Vision Res. 25 1569 1576 3832580
Orefice L.L. Zimmerman A.L. Chirila A.M. Sleboda S.J. Head J.P. Ginty D.D. 2016 Peripheral mechanosensory neuron dysfunction underlies tactile and behavioral deficits in mouse models of ASDs article peripheral mechanosensory neuron dysfunction underlies tactile and behavioral deficits in mouse models of ASDs Cell 166 299 313 27293187
Peeters B.W.M.M. Moeskops M. Veenvliet A.R.J. 2016 Color preference in Danio rerio: effects of age and anxiolytic treatments Zebrafish 13 330 334 27333080

상세보기
Richendrfer H. Pelkowski S.D. Colwill R.M. Creton R. 2012 On the edge: pharmacological evidence for anxiety-related behavior in zebrafish larvae Behav. Brain Res. 228 99 106 22155488

상세보기
Robertson D.S. McKenna M.C. Toon O.B. Hope S. Lillegraven J.A. 2004 Survival in the first hours of the cenozoic Bull. Geol. Soc. Am. 116 760 768
Singh A.P. Nüsslein-Volhard C. 2015 Zebrafish stripes as a model for vertebrate colour pattern formation Curr. Biol. 25 R81 R92 25602311

상세보기
Sugimoto M. Yuki M. Miyakoshi T. Maruko K. 2005 The influence of long-term chromatic adaptation on pigment cells and striped pigment patterns in the skin of the zebrafish, Danio rerio J. Exp. Zool. Part A Comp. Exp. Biol. 303A 430 440
Sung Y.H. Kim J.M. Kim H.T. Lee J. Jeon J. Jin Y. Choi J.H. Ban Y.H. Ha S.J. Kim C.H. 2014 Highly efficient gene knockout in mice and zebrafish with RNA-guided endonucleases Genome Res. 24 125 131 24253447

상세보기

내보내기 구분	파일저장 인쇄 메일전송
구성항목	기본정보 상세정보 관리번호, 논문명, 저널/프로시딩명, 저자 , 발행년, 권, 호, 시작페이지, 끝페이지, 발행기관 관리번호, 논문명, 대등논문명, 저자 , 저널/프로시딩명, 발행기관, 발행년, 발행언어, 권, 호, 시작페이지, 끝페이지, ISBN, ISSN, 주제분야, 키워드, 초록(한글), 초록(영문), 저자(소속기관)
저장형식	Text(ASCII format) Excel format RefWorks Direct Export RIS format (for Reference Manager, ProCite, EndNote), Scholar's Aids, Mendeley
메일정보	받는사람 (필수) @ 보내는사람 (선택) @ 제목 내용 KISTI 검색결과 이메일 서비스
안내	총 건의 자료가 검색되었습니다. 다운받으실 자료의 인덱스를 입력하세요. (1-10,000) 검색결과의 순서대로 최대 10,000건 까지 다운로드가 가능합니다. 데이타가 많을 경우 속도가 느려질 수 있습니다.(최대 2~3분 소요) 다운로드 파일은 UTF-8 형태로 저장됩니다. 파일의 내용이 제대로 보이지 않을실 때는 웹브라우저 상단의 보기 -> 인코딩 -> 자동선택 여부를 확인하십시오. ~ Text(ASCII format) Excel format

연합인증