C-myc antisense oligonucleotides and methods for using the same to treat cell-proliferative disorders
원문보기
IPC분류정보
국가/구분
United States(US) Patent
등록
국제특허분류(IPC7판)
C07H-021/04
C12N-015/113
출원번호
US-0829594
(2013-03-14)
등록번호
US-9228189
(2016-01-05)
발명자
/ 주소
Gryaznov, Sergei M.
Zielinska, Daria
Pruzan, Ronald A.
Lindquist, Jeffrey N.
출원인 / 주소
Geron Corporation
대리인 / 주소
Morrison & Foerster LLP
인용정보
피인용 횟수 :
1인용 특허 :
24
초록
Provided herein are antisense oligonucleotides that can effectively prevent or decrease c-myc protein expression as well as decrease overall rates of cell proliferation in in vitro and mammalian in vivo models of cell proliferative disorders as well as methods for using the same.
대표청구항▼
1. An oligonucleotide comprising a sequence complementary to an mRNA from a c-myc gene, wherein the nucleoside subunits of the oligonucleotide are joined by intersubunit linkages, wherein the oligonucleotide comprises two or more N3′→ P5′ thiophosphoramidate linkages independently located on both th
1. An oligonucleotide comprising a sequence complementary to an mRNA from a c-myc gene, wherein the nucleoside subunits of the oligonucleotide are joined by intersubunit linkages, wherein the oligonucleotide comprises two or more N3′→ P5′ thiophosphoramidate linkages independently located on both the 5′ and 3′ ends of the oligonucleotide, wherein the oligonucleotide further comprises two or more contiguous thiophosphate or phosphate linkages located in between the two or more N3′→ P5′ thiophosphoramidate linkages, wherein the oligonucleotide is about 6 to about 30 nucleotides in length, and wherein the oligonucleotide is a substrate for RNase-H-mediated degradation of the mRNA from a c-myc gene. 2. The oligonucleotide of claim 1, wherein the oligonucleotide comprises five contiguous N3′→ P5′ thiophosphoramidate linkages located on the 5′ end of the oligonucleotide, four contiguous N3′→ P5′ thiophosphoramidate linkages located on the 3′ end of the oligonucleotide, and six contiguous thiophosphate or phosphate linkages located between the five contiguous N3′→ P5′ thiophosphoramidate linkages located on the 5′ end of the oligonucleotide and the four contiguous N3′→ P5′ thiophosphoramidate linkages located on the 3′ end of the oligonucleotide. 3. The oligonucleotide of claim 1, wherein the oligonucleotide is at least 95% complementary to an mRNA from a c-myc gene at the site of the mRNA's translation initiation region. 4. The oligonucleotide of claim 1, wherein the oligonucleotide comprises the sequence ACGTTGAGGGGCAT (SEQ ID NO:15) or the sequence TCGTCGCGGGAGGCTG (SEQ ID NO:16). 5. The oligonucleotide of claim 1 wherein the oligonucleotide comprises a sequence selected from the group consisting of AACGTTGAGGGGCAT (SEQ ID NO:1), UAACGTTGAGGGGCA (SEQ ID NO:2), TAACGTTGAGGGGCAT (SEQ ID NO:3), TTTCATTGTTTTCCA (SEQ ID NO:4), CTCGTCGTTTCCGCAACAAG (SEQ ID NO:6), ACGTTGAGGGGCATCGTCGC (SEQ ID NO:7), AACGTTGAGGGGCATCGTCG (SEQ ID NO:8), CTGCTGTCGTTGAGAGGGTA (SEQ ID NO:9), GGCATCGTCGCGGGAGGCTGCTGGAGCG (SEQ ID NO:10), GGCATCGTCGCGGGAGGCTG (SEQ ID NO:11), TCGTCGCGGGAGGCTGCTGG (SEQ ID NO:12), CCGCCCGCTCGCTCCCTCTG (SEQ ID NO:13), and GTTCTCCTCCTCGTCGCAGT (SEQ ID NO:14). 6. An oligonucleotide comprising a sequence complementary to an mRNA from a c-myc gene, wherein the nucleoside subunits of the oligonucleotide are joined by intersubunit linkages, wherein the oligonucleotide is a substrate for RNase-H-mediated degradation of the mRNA from a c-myc gene, and a. wherein the oligonucleotide comprises at least two contiguous N3′→ P5′ thiophosphoramidate intersubunit linkages located on the 5′ end of the oligonucleotide;b. wherein the oligonucleotide comprises at least two contiguous N3′→ P5′ thiophosphoramidate intersubunit linkages located on the 3′ end of the oligonucleotide;c. wherein the oligonucleotide comprises 2-11 contiguous thiophosphate or phosphate linkages located in between said at least two contiguous N3′→ P5′ thiophosphoramidate linkages located on the 5′ end and said at least two contiguous N3′→ P5′ thiophosphoramidate linkages located on the 3′ end of the oligonucleotide; andd. wherein the oligonucleotide comprises the sequence AACGTTGAGGGGCAT (SEQ ID NO:1). 7. The oligonucleotide of claim 1, wherein contacting the oligonucleotide with a proliferating cell decreases relative c-myc protein expression in the cell by at least about 50% in comparison to cells that have not been contacted with the oligonucleotide. 8. The oligonucleotide of claim 1, wherein contacting the oligonucleotide with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than 50% in comparison to cells that have not been contacted with the oligonucleotide. 9. The oligonucleotide of claim 1, wherein the oligonucleotide further comprises one or more lipid or cholesterol moieties. 10. The oligonucleotide of claim 9, wherein the one or more lipid or cholesterol moieties is/are located on the 5′ end of the oligonucleotide, the 3′ end of the oligonucleotide, or both the 5′ and 3′ ends of the oligonucleotide. 11. The oligonucleotide of claim 10, wherein the lipid or the cholesterol moiety is located on the 5′ end of the oligonucleotide. 12. The oligonucleotide of claim 10, wherein the lipid moiety comprises a Caprylic acid, a Capric acid, a Lauric acid, a Myristic acid, a Palmitic acid, a Stearic acid, a Arachidic acid, a Behenic acid, a Lignoceric acid, or a Cerotic acid. 13. The oligonucleotide of claim 12, wherein the lipid moiety comprises a Palmitic acid. 14. The oligonucleotide of claim 1 wherein the oligonucleotide further comprises a fluorescent dye label. 15. The oligonucleotide of claim 14, wherein the fluorescent dye label is carboxytetramethylrhodamine (TAMRA). 16. A pharmaceutical composition comprising one or more oligonucleotides of claim 1. 17. The pharmaceutical composition of claim 16, further comprising a pharmaceutically acceptable carrier. 18. A method for treating or preventing a cell proliferative disorder in an individual in need thereof comprising: administering to the individual a therapeutically effective amount of one or more of the oligonucleotides of claim 1 wherein administration of one or more of the oligonucleotides relieves at least one symptom of the cell proliferative disorder. 19. The method of claim 18, wherein the cell proliferative disorder is cancer. 20. The method of claim 19, wherein the cancer is liver cancer or a cancer resulting from B-cell proliferation. 21. The method of claim 18, wherein the individual is human. 22. A kit comprising one or more of the oligonucleotides of claim 1. 23. The oligonucleotide of claim 1, wherein the oligonucleotide comprises two or more contiguous N3′→ P5′ thiophosphoramidate linkages independently located on both the 5′ and 3′ ends of the oligonucleotide. 24. An oligonucleotide comprising a sequence complementary to an mRNA from a c-myc gene, wherein the nucleoside subunits of the oligonucleotide are joined by intersubunit linkages, wherein the oligonucleotide comprises two or more N3′→ P5′ thiophosphoramidate or N3′→ P5′ phosphoramidate linkages independently located on both the 5′ and 3′ ends of the oligonucleotide, wherein the oligonucleotide comprises two or more contiguous thiophosphate or phosphate linkages located in between the two or more N3′→ P5′ thiophosphoramidate or N3′→ P5′ phosphoramidate linkages, wherein the oligonucleotide is about 6 to about 30 nucleotides in length, wherein the oligonucleotide is a substrate for RNase-H-mediated degradation of the mRNA from a c-myc gene, and wherein the oligonucleotide comprises a sequence selected from the group consisting of CTGCTGTCGTTGAGAGGGTA (SEQ ID NO:9), GGCATCGTCGCGGGAGGCTGCTGGAGCG (SEQ ID NO:10), GGCATCGTCGCGGGAGGCTG (SEQ ID NO:11), TCGTCGCGGGAGGCTGCTGG (SEQ ID NO:12), CCGCCCGCTCGCTCCCTCTG (SEQ ID NO:13), GTTCTCCTCCTCGTCGCAGT (SEQ ID NO:14), and TCGTCGCGGGAGGCTG (SEQ ID NO:16). 25. The oligonucleotide of claim 24, wherein the oligonucleotide comprises two or more contiguous N3′→ P5′ thiophosphoramidate or N3′→ P5′ phosphoramidate linkages independently located on both the 5′ and 3′ ends of the oligonucleotide. 26. The oligonucleotide of claim 24, wherein the oligonucleotide comprises five contiguous N3′→ P5′ thiophosphoramidate or N3′→ P5′ phosphoramidate linkages located on the 5′ end of the oligonucleotide, four contiguous N3′→ P5′ thiophosphoramidate or N3′→ P5′ phosphoramidate linkages located on the 3′ end of the oligonucleotide, and six contiguous thiophosphate or phosphate linkages located between the five contiguous N3′→ P5′ thiophosphoramidate or N3′→ P5′ phosphoramidate linkages located on the 5′ end of the oligonucleotide and the four contiguous N3′→ P5′ thiophosphoramidate or N3′→ P5′ phosphoramidate linkages located on the 3′ end of the oligonucleotide. 27. The oligonucleotide of claim 24, wherein contacting the oligonucleotide with a proliferating cell decreases relative c-myc protein expression in the cell by at least about 50% in comparison to cells that have not been contacted with the oligonucleotide. 28. The oligonucleotide of claim 24, wherein contacting the oligonucleotide with a population of proliferating cells decreases the relative cell growth rate of the population of cells by greater than 50% in comparison to cells that have not been contacted with the oligonucleotide. 29. The oligonucleotide of claim 24, wherein the oligonucleotide further comprises one or more lipid or cholesterol moieties. 30. The oligonucleotide of claim 29, wherein the one or more lipid or cholesterol moieties is/are located on the 5′ end of the oligonucleotide, the 3′ end of the oligonucleotide, or both the 5′ and 3′ ends of the oligonucleotide. 31. The oligonucleotide of claim 30, wherein the lipid or the cholesterol moiety is located on the 5′ end of the oligonucleotide. 32. The oligonucleotide of claim 30, wherein the lipid moiety comprises a Caprylic acid, a Capric acid, a Lauric acid, a Myristic acid, a Palmitic acid, a Stearic acid, a Arachidic acid, a Behenic acid, a Lignoceric acid, or a Cerotic acid. 33. The oligonucleotide of claim 32, wherein the lipid moiety comprises a Palmitic acid. 34. The oligonucleotide of claim 24, wherein the oligonucleotide further comprises a fluorescent dye label. 35. The oligonucleotide of claim 34, wherein the fluorescent dye label is carboxytetramethylrhodamine (TAMRA). 36. A pharmaceutical composition comprising one or more oligonucleotides of claim 24. 37. The pharmaceutical composition of claim 36, further comprising a pharmaceutically acceptable carrier. 38. A kit comprising one or more of the oligonucleotides of claim 24. 39. The oligonucleotide of claim 1 wherein the oligonucleotide is selected from the group consisting of ODN No. 16 (corresponding to the nucleic acid sequence of SEQ ID NO: 1), ODN No. 17 (corresponding to the nucleic acid sequence of SEQ ID NO: 3), ODN No. 32 (corresponding to the nucleic acid sequence of SEQ ID NO: 1), and ODN No.33 (corresponding to the nucleic acid sequence of SEQ ID NO: 3), as shown in Table 7.
연구과제 타임라인
LOADING...
LOADING...
LOADING...
LOADING...
LOADING...
이 특허에 인용된 특허 (24)
Zalewski Andrew ; Shi Yi, Antisense inhibition of c-myc to modulate the proliferation of smooth muscle cells.
Liu, Yijia; Lu, Patrick Y.; Woodle, Martin C.; Xie, Frank Y., Composition and method of RNAi therapeutics for treatment of cancer and other neovascularization diseases.
Liu, Yijia; Lu, Patrick Y.; Woodle, Martin C.; Xie, Frank Y., Composition and methods of RNAi therapeutics for treatment of cancer and other neovascularization diseases.
Liu, Yijia; Lu, Patrick Y.; Woodle, Martin C.; Xie, Frank Y., Composition and methods of RNAi therapeutics for treatment of cancer and other neovascularization diseases.
Liu, Yijia; Lu, Patrick Y.; Woodle, Martin C.; Xie, Frank Y., Composition and methods of RNAi therapeutics for treatment of cancer and other neovascularization diseases.
Liu, Yijia; Lu, Patrick Y.; Woodle, Martin C.; Xie, Frank Y., Composition and methods of RNAi therapeutics for treatment of cancer and other neovascularization diseases.
Letsinger Robert L. (Wilmette IL) Gryaznov Sergei M. (San Mateo CA), Oligodeoxyribonucleotides including 3′-aminonucleoside-phosphoramidate linkages and terminal 3′-amino groups.
Letsinger Robert L. (316 3rd St. Wilmette IL 60091) Gryaznov Sergei M. (2 Clark Dr. San Mateo CA 94401), Oligonucleotides having modified internucleoside linkages.
Hirschbein Bernard L. ; Fearon Karen L. ; Gryaznov Sergei M. ; McCurdy Sarah N. ; Nelson Jeffery S. ; Schultz Ronald G., Solid phase synthesis of oligonucleotide N3'-P5' phosphoramidates.
Hirschbein Bernard L. ; Fearon Karen L. ; Gryaznov Sergei M. ; McCurdy Sarah N. ; Nelson Jeffrey S. ; Schultz Ronald G., Synthons for synthesis of oligonucleotide N3-P5 phosphoramidates.
※ AI-Helper는 부적절한 답변을 할 수 있습니다.