로그인시 본인확인과정이 필요할 수 있습니다.
다음과 같은 기능을 한번의 로그인으로 사용 할 수 있습니다.
NTIS 바로가기
다음과 같은 기능을 한번의 로그인으로 사용 할 수 있습니다.
DataON 바로가기
다음과 같은 기능을 한번의 로그인으로 사용 할 수 있습니다.
Edison 바로가기
다음과 같은 기능을 한번의 로그인으로 사용 할 수 있습니다.
Kafe 바로가기
| 국가/구분 | United States(US) Patent 등록 |
|---|---|
| 국제특허분류(IPC7판) |
|
| 출원번호 | US-0619194 (2012-09-14) |
| 등록번호 | US-9534252 (2017-01-03) |
| 발명자 / 주소 |
|
| 출원인 / 주소 |
|
| 대리인 / 주소 |
|
| 인용정보 | 피인용 횟수 : 0 인용 특허 : 401 |
The present invention relates to the fields of biotechnology and molecular biology. In particular, the present invention relates to the construction and use of nucleic acid molecules comprising cloning sites which differ in nucleotide sequence. In particular embodiments, the present invention relate
The present invention relates to the fields of biotechnology and molecular biology. In particular, the present invention relates to the construction and use of nucleic acid molecules comprising cloning sites which differ in nucleotide sequence. In particular embodiments, the present invention relates to nucleic acid molecules which contain recombination sites with different primer binding sites. These different primer binding sites may be used to sequence different ends of nucleic acid segments located between the two recombination sites.
1. A method for sequencing all or part of a nucleic acid segment, the method comprising; (a) performing a topoisomerase cloning reaction comprising:(i) providing the nucleic acid segment which comprises a 3′ overhang at each end;(ii) providing a second nucleic acid molecule having a 5′ overhang at e
1. A method for sequencing all or part of a nucleic acid segment, the method comprising; (a) performing a topoisomerase cloning reaction comprising:(i) providing the nucleic acid segment which comprises a 3′ overhang at each end;(ii) providing a second nucleic acid molecule having a 5′ overhang at each end complementary to the 3′ ends and a covalently linked topoisomerase at each of the 5′ ends and wherein the second nucleic acid molecule also comprises at each of the 5′ ends a first attL site and a second attL site which do not recombine with each other and wherein the first and the second attL sites each have a sequencing primer binding site wherein the sequencing primer binding sites encompass the IHF site of the first and the second attL sites and wherein the sequencing primer binding sites differ from each other by one, two, three or four nucleotides;(iii) combining the nucleic acid segment with the second nucleic acid molecule such that the 3′ overhang of the nucleic acid segment hybridizes with the 5′ overhang of the second nucleic acid molecule and the covalently linked topoisomerase ligates the nucleic acid segment and the second nucleic acid molecule resulting in the generation of a product nucleic acid molecule comprising the second nucleic acid molecule and the nucleic acid segment and allow for sequencing of the nucleic acid segment from the first and the second attL sites;(b) contacting a first set of the product nucleic acid molecule of (a) with a first sequencing primer which hybridizes to both of the primer binding sites of the product nucleic acid molecule, wherein the first sequencing primer mediates 5′ to 3′ extension from only one of the two binding sites and sequencing all or part of the nucleic acid segment with the first sequencing primer. 2. The method of claim 1, further comprising the steps of: (c) contacting a second set of the product nucleic acid molecule of (a) with a second sequencing primer which hybridizes to both of the primer binding sites of the product nucleic acid molecule, wherein the second sequencing primer mediates 5′ to 3′ extension only from the primer binding site at the opposite end of the nucleic acid segment from the primer binding site bound by the first sequencing primer and sequencing all or part of the nucleic acid segment with the second sequencing primer. 3. The method of claim 2, wherein the first sequencing primer and the second sequencing primer are each between 15 and 45 nucleotides in length. 4. The method of claim 3, wherein the difference in nucleotide sequence of the first sequencing primer and the second sequencing primer is at the 3′ termini therein. 5. The method of claim 4, wherein the first sequencing primer comprises the nucleotide sequence 5′ GTTGCAACAAATTGATGAGCAATTA 3′ (SEQ ID NO. 1) and the second sequencing primer comprises the nucleotide sequence 5′ GTTGCAACAAATTGATGAGCAATGC 3′ (SEQ ID NO. 2).
해당 특허가 속한 카테고리에서 활용도가 높은 상위 5개 콘텐츠를 보여줍니다.
더보기 버튼을 클릭하시면 더 많은 관련자료를 살펴볼 수 있습니다.
Copyright KISTI. All Rights Reserved.
※ AI-Helper는 부적절한 답변을 할 수 있습니다.