저온저항성 BN115 gene과 표지유전자로서 kanamycin에 저항성 있는 nptII gene을 가지고 있는 식물발현용 binary vector pBin19/BNl15가 도입된 A. tumefacience MP90을 국화잎과 공동배양 하였다. 또한 particle bombardment를 이용하여 목적으로 하는 유전자가 식물체에 안정적으로 도입되어 발현됨을 PCR 및 Real-Time PCR 검정으로 확인하였다. 국화잎과 공동배양에 사용된 Agrobacterium은 $5.0{\times}1.0{\mu}m$로 non-sporing, motile, rod 형이며, Callus는 pin이나 cork-borer에 의해 상처 난 잎 가장자리로부터 형성되어 식물체가 재분화 되었다. 유전자 도입조건은 Agrobacterium을$O.D._{600}{\approx}0.5$에서 20분간 공동배양 할 때, Particle bombardment는 helium 압력을 1,100 psi, target 거리를 9 cm로 유지했을 때, 가장 효율이 높았다. 5mg/L kanamycin이 들어 있는 배지에서 선발된 형질전환체는 PCR 분석으로 형질전환여부를 판별할 수 있었으며, 선발 10개체 중 9개체에서 purified pBN115와 같은 크기의 밴드가 형성되었다. Taq-Man probe를 이용한 Real-Time PCR 결과 $45{\sim}0.00045ng/{\mu}{\ell}$ 범위에서 pBN115 gene을 10배씩 serial dilution한 amplification plot는 일정한 간격으로 standard curve를 보였으며, slope는 -3.313975, R2는 0.998319이었다. Amplification plots의 형질전환체 $C_T$값은 $20.75{\sim}33.81$범위였으며, 유전자 copy수는 정량분석을 기초로 산출하였다. pBN115의 plasmid DNA를 serial dilution했을 때, standard는 $5.6{\times}10^{10}/45ng{\sim} 5.6{\times}10^5/0.00045ng\;copies/{\mu}{\ell}$이 었으며, 형질전환체는 $3.86{\times}10^8{\sim}12565.71 copies/{\mu}{\ell}$이었다. 따라서 PCR, Real-Time PCR 분석 결과 저온저항성 유전자가 국화의 genome에 안정적으로 도입되었음이 확인되었다.
저온저항성 BN115 gene과 표지유전자로서 kanamycin에 저항성 있는 nptII gene을 가지고 있는 식물발현용 binary vector pBin19/BNl15가 도입된 A. tumefacience MP90을 국화잎과 공동배양 하였다. 또한 particle bombardment를 이용하여 목적으로 하는 유전자가 식물체에 안정적으로 도입되어 발현됨을 PCR 및 Real-Time PCR 검정으로 확인하였다. 국화잎과 공동배양에 사용된 Agrobacterium은 $5.0{\times}1.0{\mu}m$로 non-sporing, motile, rod 형이며, Callus는 pin이나 cork-borer에 의해 상처 난 잎 가장자리로부터 형성되어 식물체가 재분화 되었다. 유전자 도입조건은 Agrobacterium을$O.D._{600}{\approx}0.5$에서 20분간 공동배양 할 때, Particle bombardment는 helium 압력을 1,100 psi, target 거리를 9 cm로 유지했을 때, 가장 효율이 높았다. 5mg/L kanamycin이 들어 있는 배지에서 선발된 형질전환체는 PCR 분석으로 형질전환여부를 판별할 수 있었으며, 선발 10개체 중 9개체에서 purified pBN115와 같은 크기의 밴드가 형성되었다. Taq-Man probe를 이용한 Real-Time PCR 결과 $45{\sim}0.00045ng/{\mu}{\ell}$ 범위에서 pBN115 gene을 10배씩 serial dilution한 amplification plot는 일정한 간격으로 standard curve를 보였으며, slope는 -3.313975, R2는 0.998319이었다. Amplification plots의 형질전환체 $C_T$값은 $20.75{\sim}33.81$범위였으며, 유전자 copy수는 정량분석을 기초로 산출하였다. pBN115의 plasmid DNA를 serial dilution했을 때, standard는 $5.6{\times}10^{10}/45ng{\sim} 5.6{\times}10^5/0.00045ng\;copies/{\mu}{\ell}$이 었으며, 형질전환체는 $3.86{\times}10^8{\sim}12565.71 copies/{\mu}{\ell}$이었다. 따라서 PCR, Real-Time PCR 분석 결과 저온저항성 유전자가 국화의 genome에 안정적으로 도입되었음이 확인되었다.
With the use of Agrobacterium and gene-gun, cold regulated gene (BN115) has been injected in Chrysanthemum leaf disc and transgenic plants have been produced successfully on the selection media containing phytohormone. To determine the presence of the transferred cold regulated gene (BN115) in the t...
With the use of Agrobacterium and gene-gun, cold regulated gene (BN115) has been injected in Chrysanthemum leaf disc and transgenic plants have been produced successfully on the selection media containing phytohormone. To determine the presence of the transferred cold regulated gene (BN115) in the transgenic Chrysanthemum, PCR-amplification indicated the presence of that gene. Real-Time PCR for confirmation of the putative transgenic plants was established. The copy number of cold regulated gene (BN115) is extrapolated on the basis of a standard curve. Serial dilutions of known number of gene copies were in triplicates. In this diagram, PCR cycles are plotted against the fluorescence intensity. The cycle at which the fluorescence reaches a threshold cycle is inversely proportional to the starting amount of target DNA.
With the use of Agrobacterium and gene-gun, cold regulated gene (BN115) has been injected in Chrysanthemum leaf disc and transgenic plants have been produced successfully on the selection media containing phytohormone. To determine the presence of the transferred cold regulated gene (BN115) in the transgenic Chrysanthemum, PCR-amplification indicated the presence of that gene. Real-Time PCR for confirmation of the putative transgenic plants was established. The copy number of cold regulated gene (BN115) is extrapolated on the basis of a standard curve. Serial dilutions of known number of gene copies were in triplicates. In this diagram, PCR cycles are plotted against the fluorescence intensity. The cycle at which the fluorescence reaches a threshold cycle is inversely proportional to the starting amount of target DNA.
* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.
문제 정의
이러한 분자육종 기술은 신품종을 단시간에 육성할 수 있는 장점이 있다. 따라서 본 연구는 저온 저항성 유전자인 BN115를 이용하여 국화에 형질 전환하기 위한 방법 및 형질전환된 식물체 내에 목적으로 하는 유전자가 안정적으로 도입되어 발현됨을 확인하고자 수행하였다.
유전자 접종조건 설정을 위하여 Agrobacterium 및 par- ticle bombardment에 의한 효율적 유전자 도입방법에 관한 연구를 수행하였다. Agrobacterium에 의한 유전자 접종조건은 0.
제안 방법
최종 DNA 산물은 agarose gel 전기영동과 흡광도 260 nm 측정치와 비교한 후 정량하여 형질 전환 체선 발을 위한 PCR분석에 사용하였다. PCR 검정에 nptn gene 의 증폭을 위한 primer는 700 bp의 PCR 산물을 증폭하는 forward primer ATGGGGAGCGGCGATACCGTA 와 reverse primer GAGGCTATTCGGCTATGACTG를 사용하였으며, PCR 증폭은 Gradient Type Program Temp. Control System PC-818 (Astec, Japan)을 사용하여 94 ℃ 에서 4분간 pre-denaturation을 반응시키고, 94 ℃에서 1 분, 57 ℃에서 1분, 72E에서 1.
유전자 접종 후 5 mg/L kanamycin과 300 m^L cefbtaxime이 함유된 MS 기본배지에서 4~6주 후 형질전환체를 1차로 배지내 선발하였다. Particle bombardment (PDS-1000, Bio-Rad)에 의한 접종은 유전자가 들어 있는 E. coli로부터 plasmid DNA를 분리하여 (Plasmid Miniprep kit. Corebiosystem co. Ltd., Korea) 1.0 p gold-microcarrier에 coating시킨 후 4℃에 미리 보관된 국화잎 절편에 접종하였으며, Helium 압력 (psi) 및 접종거리에 따른 형질 전환율을 조사하였다.
또한 TaqMan reaction을 위한 AmpliTaq Gold DNA poly merase, AmpErase UNG, dNTPs, Passive reference dye (ROX), Buffer 등이 포함된 TaqMan universal Master Mix 는 Applied Biosystems로부터 공급받아 사용하였다. Real- Time PCR 반응은 총량 25 ㎕에 1 ㎕ DNA (30 ng), 12.5 ㎕ 2X TaqMan univers이 PCR master mixture, 1.25 ㎕ TaqMan BN115 probe mixture, 10.25 RNase-free water를 혼합하여 최초 95℃에서 10분간 반응시키고, 95℃에서 15초와 60℃에서 1분간의 cycle을 40회하여 각 sample 당 3회 반복으로 실시하였다. Standard curve는 positive control (purified pBN115)을 45, 4.
Real-Time PCR 분석은 Real-Time PCR 7500 system (Applied Biosystems, USA)을 사용하였으며, PCR 반응을 위 한 TaqMan BN115 probe는 Applied Biosystems에서 합성하였다. Probe는 forward primer (5' to 3') AAGTCGT- TGATCTACGCCGATAAA와 reverse primer (5' to 3') GCTCTCTTTGTGGCTTCATTGAG로 합성되었다.
25 RNase-free water를 혼합하여 최초 95℃에서 10분간 반응시키고, 95℃에서 15초와 60℃에서 1분간의 cycle을 40회하여 각 sample 당 3회 반복으로 실시하였다. Standard curve는 positive control (purified pBN115)을 45, 4.5, 0.45, 0.045, 0.0045, 0.00045 ng/㎕를 10-fbld serial dilution하여 curve를 그린 후 unknown samples과 비교하여 7500 system SDS software v.l .3 (Applied Biosystems, USA)에 의해 분석하였다 (Ding et al. 2004). pBN115량에 따른 유전자 copy수 측정방법은 1.
국화잎으로부터 식물체 재분화를 위해서는 3% sucrose가 첨가된 MS 기본배지 에 생장조정제 1.0 mg/L BA와 0.3 mg/L 2, 4-D를 첨가하여 배지를 재조합한 다음 잎 절편 중앙을 핀으로 상처를 가한 후 접종하였다. 재분화 관찰은 해부현미경 및 SEM (Scanning Electron Microscopy)을 사용하여 Agrobacterium 형태, 식물체내로 침입과정, callus형성과정 등을 관찰하였다.
잘못 판별하는 경우가 생긴다. 따라서 국화 형질전환체로부터 추출한 gDNA를 가지고 Real-Time'0CR에 의한 유전자의 존재여부를 확인하였다. TaqMan probe를 이용한 BN115 gene의 Real-Time PCR 결과 slope는 -3.
tumefacience MP90을 국화잎과 공동배양 하였다. 또한 particle bombardment를 이용하여 목적으로 하는 유전자가 식물체에 안정적으로 도입되어 발현됨을 PCR 및 Real-Time PCR 검정으로 확인하였다. 국화잎과 공동배양에 사용된 A양mbacferium은 5.
셋째 날 IM (Induction Media) +As (Acetosyringone) broth에서 6시간 배양한 후 국화잎과 공동 배양하였다. 유전자 접종 후 5 mg/L kanamycin과 300 m^L cefbtaxime이 함유된 MS 기본배지에서 4~6주 후 형질전환체를 1차로 배지내 선발하였다. Particle bombardment (PDS-1000, Bio-Rad)에 의한 접종은 유전자가 들어 있는 E.
특히 20-30 nt의 TaqMan probe를 이용하여 forward^}- reverse primer 사이의 internal sequence# 인식함으로써 일반적인 PCR 방법보다 선택적으로 PCR product를 검출 할 수 있다. 이 probe는 5'-end에 있는 fl니orescent reporter dye와 3'-end에 있는 quencher dye를 labeling하며, reporter dye와 quencher dye의 FRET (Fluorescent Resonance Energy Transfer) 현상을 이용하여 증폭산물이 증가되는 양을 모니터링 한다. DNA를 정량하기 위하여 Ct (threshold cycle) 값을 이용하는데, PCR product 축적에 의한 Ct값은 star ting template amount와 상호관련 있다.
3 mg/L 2, 4-D를 첨가하여 배지를 재조합한 다음 잎 절편 중앙을 핀으로 상처를 가한 후 접종하였다. 재분화 관찰은 해부현미경 및 SEM (Scanning Electron Microscopy)을 사용하여 Agrobacterium 형태, 식물체내로 침입과정, callus형성과정 등을 관찰하였다.
저온저항성 BN115 gene과 표지유전자로서 kanamycin에저항성 있는 nptn gene을 가지고 있는 식물발현용 binary vector pBinl9/BNl 15가 도입된 A. tumefacience MP90과 국화잎을 공동배양한 후 5 mg/L kanamycin이 들어있는 MS +3%sucrose 배지에서 4〜6주 후 선발된 123개의 임의 형질전환체 중 10개체를 대표로 선발하여 PCR 및 Real-Time PCR 검정을 실시하여 형질전환여부를 판별하였다. 식물체로부터 gDNA를 추출하여 표지유전자인 nptn gene을 증폭하도록 제작된 primer를 이용하여 PCR 검정 결과 비 형질전환체 (wild type)는 증폭되지 않았으나 대표 선발된 10 개 중 9개의 형질전환체는 purified pBN 115 (+ve control) 와 같은 크기의 700 bp에서 밴드가 형성되었다 (Figure 2).
, Korea)를 이용하여 DNA를 추출하였으며, genomic DNA 정량에 앞서 RNase 가 처리되었다. 최종 DNA 산물은 agarose gel 전기영동과 흡광도 260 nm 측정치와 비교한 후 정량하여 형질 전환 체선 발을 위한 PCR분석에 사용하였다. PCR 검정에 nptn gene 의 증폭을 위한 primer는 700 bp의 PCR 산물을 증폭하는 forward primer ATGGGGAGCGGCGATACCGTA 와 reverse primer GAGGCTATTCGGCTATGACTG를 사용하였으며, PCR 증폭은 Gradient Type Program Temp.
대상 데이터
Probe는 forward primer (5' to 3') AAGTCGT- TGATCTACGCCGATAAA와 reverse primer (5' to 3') GCTCTCTTTGTGGCTTCATTGAG로 합성되었다. 또한 TaqMan reaction을 위한 AmpliTaq Gold DNA poly merase, AmpErase UNG, dNTPs, Passive reference dye (ROX), Buffer 등이 포함된 TaqMan universal Master Mix 는 Applied Biosystems로부터 공급받아 사용하였다. Real- Time PCR 반응은 총량 25 ㎕에 1 ㎕ DNA (30 ng), 12.
5 cm, 화심 색이 황백색 (저온기 녹색)인 특성이 있다. 본 실험에 사용된 BN115 gene은 겨울유채 품종인 Jetneuf 식물체를 2℃조건에서 저온처리한 후 발현되는 유전자를 cloning한 것으로 저온처리 후 24시간이내에 잎에서 유전자가 발현되는 것으로 보고되고 있다 (Weretilnyk et al. 1993). 현재 유리온실과 비닐하우스 등 국내 총 시설 재배면적은 10만 4천 ha로 시설내 작물 생육온도를 1℃만 낮추어도 연간 660억원의 보온 경비를 절감할 수 있다 (농림부, 2004).
8-1.0 cm! 잎 절편을 형질전환용 재료로 사용하였다.
저온저항성 BN115 gene과 표지유전자로서 kanamycin에 저항성 있는 nptn gene을 가지고 있는 식물발현용 binary vector pBinl9/BNl 15가 도입된 A. tumefacience MP90을 국화잎과 공동배양 하였다. 또한 particle bombardment를 이용하여 목적으로 하는 유전자가 식물체에 안정적으로 도입되어 발현됨을 PCR 및 Real-Time PCR 검정으로 확인하였다.
2000, Fu et al 1999). 저온저항성 유전자를 함유하고 있는 4 tumefaciens MP 90는 경희대학교 Dr. Yang이 Agriculture Canada의 Dr. Singh로부터 공여 받은 균주로 50 mg^L kanamycin이첨가된 LB broth배지에 접종한 후 2〜3일 동안 28 ℃ 암 조건에서 배양하였다.
저온저항성 형질전환체 육성을 위해 사용한 저온관련 유전자는 BN115는 Brassica napus에서 분리된 것으로 binary vector에 도입하여 pBinl9::BNl 15로 재조합한 다음 disarmed Ti-plasmid를 함유하고 있는 A. tumefaciens MP90에 도입한 것을 경희대학교로부터 분양받아 사용하였다 (Weretilnyk et al. 1993; Choi et al. 1996; Jeong et al. 2000, Fu et al 1999). 저온저항성 유전자를 함유하고 있는 4 tumefaciens MP 90는 경희대학교 Dr.
성능/효과
이상의 Real-Time PCR과 PCR 결과를 바탕으로 저온 저항성 BN115 gene과 표지유전자로서 kanamycin에 저항성 있는 nptn gene을 가지고 있는 식물발현용 binary vector pBinl9/BNl 15가 도입된 A. tumefacience MP90고]" 국화잎을 공동배양한 후 5 m^L kanamycin이 들어있는 배지에서 선발된 10개체 중 PCR에서는 9개체가 plasmid DNA (+ve contr이)과 같은 크기의 700bp에서 밴드가 형성되므로 형질전환체로 판별되었으나 Real-Time PCR에서는 Ct값 35 이상을 보인 T35와 T56은 비형질전환체로 판별되었다. Li 등 (2004)은 Real-Time PCR을 이용하여 형질전환체 copy 수를 계산하는 방법으로 2aaCT[ A ACt= AC? (unknown sample)-ACt (reference sample)]과 Weng 등 (2004)은 X0/R0 = 10[(CT,W-4 X)SX)*[(CT,R-IR)SR]식을 이용하였으며, Southern blot analysis와 상호 비교하여 일치 여부를 판별하였을 때 상호 일치하는 결과로 보고하였다.
998319이었다. Amplifi cation plots의 형질전환체 G값은 20.75 〜33.81 범위 였으며, 유전자 copy수는 정량분석을 기초로 산출하였다 pBNI15의 plasmid DNA를 serial dilution했을 때, standard는 5.6 x 1010/45ng - 5.6xl05/0.00045ng copies/㎕이 었으며, 형질전환체는 3.86 X108 〜 12565.71 copies/㎕이었다. 따라서 PCR, Real-Time PCR 분석 결과 저온저항성 유전자가 국화의 genome에 안정적으로 도입되었음이 확인되었다.
유전자 도입조건은 Agi^obacterium 을 0.D.600 #0.5에서 20분간 공동배양 할 때, Particle bom- bardment는 helium 압력을 1, 100 psi, target 거리를 9 cm로유지했을 때, 가장 효율이 높았다, 5n@L kanamycin이 들어 있는 배지에서 선발된 형질전환체는 PCR 분석으로 형질전환 여부를 판별할 수 있었으며, 선발 10개체 중 9개체에서 purified pBN115와 같은 크기의 밴드가 형성되었다. Taq- Man probe를 이용한 Real-Time PCR 결과 45 —0.
Agrobacterium에 의한 유전자 접종조건은 0.D.6oou0.5에서 20분간 공동배양시 callus 형성률 100%, shoot 형성률 5.1%, shoot 수 2.2개로 가장 효율적인 형질 전환율을 나타냈으며, 115개 (93.5%)의 형질 전환 체를 얻었다. 반면, Particle bombardment에 의한, 유전자접종은 helium 압력은 1, 100 psi와 target 거리를 9 cm로 조정했을 때 callus 형성률 100%, shoot 형성률 11.
Real-Time PCR 분석은 보편화된 PCR 방법에 비해 sensitivity와 specificity가 좋을 뿐만 아니 라, 증폭부터 분석까지 한 시간 이내에 완료할 수 있으며, 결과를 확인하기 위해 전기영동 단계를 생략할 수 있으므로 분석 시간 및 비용을 줄일 수 있다. 또한 컴퓨터 프로그램을 기초로 data를 정량화 할 수 있으므로 객관적인 결과를 얻을 수 있다.
5에서 20분간 공동배양 할 때, Particle bom- bardment는 helium 압력을 1, 100 psi, target 거리를 9 cm로유지했을 때, 가장 효율이 높았다, 5n@L kanamycin이 들어 있는 배지에서 선발된 형질전환체는 PCR 분석으로 형질전환 여부를 판별할 수 있었으며, 선발 10개체 중 9개체에서 purified pBN115와 같은 크기의 밴드가 형성되었다. Taq- Man probe를 이용한 Real-Time PCR 결과 45 —0.00045 ng/㎕범위에서 pBN 115 gene을 10배씩 serial dikition한 amplification plot는 일정한 간격으로 standard curve를 보였으며, slope는 -3.313975, R2는 0.998319이었다. Amplifi cation plots의 형질전환체 G값은 20.
71 copies/㎕이었다. 따라서 PCR, Real-Time PCR 분석 결과 저온저항성 유전자가 국화의 genome에 안정적으로 도입되었음이 확인되었다.
62범 위로 나타났다 (Figure 3B, Table 3). 또한 serial dilution에서 상대정량에 따른 정량분석의 정확성 test결과 CT 값의 범위는 13.41 〜29.97이었으며, SDW는 검출되지 않았다 (Table 2). 정량분석 결과를 기초로 pBN115 량에 따른 유전자 copy 수 측정 방법 을 1.
5%)의 형질 전환 체를 얻었다. 반면, Particle bombardment에 의한, 유전자접종은 helium 압력은 1, 100 psi와 target 거리를 9 cm로 조정했을 때 callus 형성률 100%, shoot 형성률 11.8%, shoot 수 2, 5개로 가장 효율적이었다 (Table 1). 이와 관련된 형질전환 방법으로 MS 액체배지에서 Agrobacterium^ 1:50으로 희석하여 잎절편과 overnight하였을 때, 2, 4~D의 농도에 따라 재분화율이 달라졌으며, 0.
tumefacience MP90과 국화잎을 공동배양한 후 5 mg/L kanamycin이 들어있는 MS +3%sucrose 배지에서 4〜6주 후 선발된 123개의 임의 형질전환체 중 10개체를 대표로 선발하여 PCR 및 Real-Time PCR 검정을 실시하여 형질전환여부를 판별하였다. 식물체로부터 gDNA를 추출하여 표지유전자인 nptn gene을 증폭하도록 제작된 primer를 이용하여 PCR 검정 결과 비 형질전환체 (wild type)는 증폭되지 않았으나 대표 선발된 10 개 중 9개의 형질전환체는 purified pBN 115 (+ve control) 와 같은 크기의 700 bp에서 밴드가 형성되었다 (Figure 2). 이는 kanamycin 배지에서 선발된 형질전환체에서 추출된 DNA안에 nptn gene이 존재함을 확인해주는 결과로 저온 저항성 유전자가 국화에 도입되었음을 의미한다.
후속연구
특히 연일 계속되는 기름값 상승에 따른 농가의 경영비 상승은 저온기 재배작목의 주요 지출비를 차지하여 농산물 가격상승의 원인으로 작용하고 있다. 따라서 저온 저항성 유전자를 이용하여 다양한 작물에 형질전환이 이루어질 경우 보온 경비를 크게 절감할 수 있어 막대한 경제적 가치가 따를 것으로 기대된다.
참고문헌 (18)
Choi KH, Yang DC, Jeon JH, Kim HS, Joung YH, Joung H (1996) Expression of cold-regulated gene in transgenic Solanum tuberosum L. Korean J Plant Tissue Culture 23: 311-315
Ding J, Jia J, Yang L, Wen H, Zhang C, Liu W, Zhang D (2004) Validation of a rice specific gene, sucrose phosphate synthase, used as the endogenous reference gene for qualitative and Real-Time quantitative PCR detection of transgenes. J Agric Food Chem 52: 3372-3377
Fu P, Singh J, Keller W, McGregor I (1999) Sucrose content and freezing tolerance of Brassice napus canola (rapeseed) seedlings overexpressing an Escherichia coli inorganic pyrophosphatase. 10th international rapeseed congress, Australia
Hernandez JBP, Remy S, Souco VG, Swennen R, Sagi L (1999) Chemotactic movement and attachment of Agrobacterium tumefaciens to banana cells and tissues. J Plant Physiol 155: 245-250
Jeong JH, Yang DC, Jang HG, Paek KY (2000) Transformation of Lettuce (Lactuca sativa L.) using cold regulated gene (BN115). Korean J Plant Tissue Culture 27: 7-12
Ke D, Menard C, Picard FJ, Boissinot M, Ouellette M, Roy PH, Bergeron MG (2000) Development of conventional and Real-Time PCR assay for the rapid detection of group B Streptococci. Clinical Chemistry 46: 324-331
Lee SW, Heinz R, Robb J, Nazar RN (1994) Differential utilization of alternate initiation sites in a plant defense gene responding to environmental stimuli. Eur J Biochem 226: 109-114
Li Z, Hansen JL, Liu Y, Zemetra RS, Berger PH (2004) Using Real-Time PCR to determine transgene copy number in wheat. Plant Molecular Biology Reporter 22: 179-188
Sherman JM, Moyer JW, Daub ME (1998a) A regeneration and Agrobacterium-mediated transformation system for genetically diverse Chrysanthemum cultivars. J Amer Soc Hort Sci 123: 189-194
Sherman JM, Moyer JW, Daub ME (1998b) Genetically engineered resistance to tomato spotted wilt virus in Chrysanthemum. Dendranthema grandiflora : A model system for virus protection in ornamental crops. Acta Hort 431: 432-441
Tinland B (1996) The integration of T -DNA into plant genomes. Trends in Plant Science I pp 178-184
Weng H, Pan A, Yang L, Zhang C, Liu Z, Zhang D (2004) Estimating number of transgene copies in transgenic rapeseed by Real-time PCR assay with HMG I/Y as an endogenous reference gene. Plant Molecular Biology Reporter 22: 289-300
Weretilnyk E, Orr W, White TC, Lu B, Singh J (1993) Characterization of three related low-temperature-regulated cDNAs from winter Brassica napus. Plant Physiol 101: 171-177
※ AI-Helper는 부적절한 답변을 할 수 있습니다.