[국내논문]새로운 유전자 재조합 방법을 이용한 대장균에서의 인간 tissue inhibitor of mtrix metalloproteinase-2 (TIMP-2) 유전자의 가용성 발현 Enhancement of the solubility of human tissue inhibitor of matrix metallocroteinase-2 (TIMP-2) in E. coli using a modified in vitro mutagenesis원문보기
암세포의 침윤은 숙주 조직의의 기저막과 세포외 기질을 침투함으로써 일어난다. 침윤과 전이과정에는 단백질가수분해 효소인 matrix metalloproteinases (MMPs)가 깊이 연관되어 있는 것으로 알려져 있으며, MMP의 가수분해 활성은 tissue inhibitors of metalloproteinases (TIMPs)라는 억제 단백질에 의해 억제된다. TIMP-2는 21kDa 크기의 포유류 단백질로 대장균에서 과발현 시 다른 많은 포유류 단백질과 마찬가지로 가용성이 낮은 봉입체 형태로 발현된다. TIMP-2 단백질의 접힘에 6개의 이황화결합이 필요하고, 이는 일반적으로 대장균 환경은 적합하지 않다. 본 연구에서는 대장균에서 불가용성으로 발현되는 TIMP-2 유전자를 유전자셔플링 기법의 한 가지인 StEP (staggered extension process)를 변형하고 동시에 $Mn^{2+}$ 농도 변화와 dGTP 불균형을 이용한 무작위 돌연변이 기법을 혼용하여 대장균에서 가용성 TMP-2 재조합 변이체를 생성하고자 하였다. 무작위로 재조합된 TIMP-2 유전자 중에서 가용성으로 발현되는 TIMP-2 유전자를 선별하기 위해서 chloramphenicol acetyltransferase (CAT)-융합 방법을 도입하였다. CAT 유전자가 가용성으로 발현되는 재조합 TIMP-2 유전자에 융합되면 이를 갖는 E. coli는 높은 chloramphenicol 환경에서 생존이 가능하게 된다. 이러한 in virro mutageuesis 기법과 CAT-융합 방법으로 대장균 가용성 TIMP-2 재조합 변이체를 14가지 얻을 수 있었다. 변이체 TIMP-2의 아미노산서열 분석과 구조 분석 결과 주로 소수성 아미노산이 친수성 아미노산으로 전환되었고, MMP와의 결합이 관여하지 않는 C-말단 부위에 돌연변이가 집중되어 있었다. 본 연구에서 개발된 간편하고 새로운 in vitro 재조합 방법과 CAT을 이용한 스크리닝 기법은 다른 많은 대장균 내 불가용성 단백질의 발현에도 사용될 수 있을 것으로 사료된다.
암세포의 침윤은 숙주 조직의의 기저막과 세포외 기질을 침투함으로써 일어난다. 침윤과 전이과정에는 단백질가수분해 효소인 matrix metalloproteinases (MMPs)가 깊이 연관되어 있는 것으로 알려져 있으며, MMP의 가수분해 활성은 tissue inhibitors of metalloproteinases (TIMPs)라는 억제 단백질에 의해 억제된다. TIMP-2는 21kDa 크기의 포유류 단백질로 대장균에서 과발현 시 다른 많은 포유류 단백질과 마찬가지로 가용성이 낮은 봉입체 형태로 발현된다. TIMP-2 단백질의 접힘에 6개의 이황화결합이 필요하고, 이는 일반적으로 대장균 환경은 적합하지 않다. 본 연구에서는 대장균에서 불가용성으로 발현되는 TIMP-2 유전자를 유전자셔플링 기법의 한 가지인 StEP (staggered extension process)를 변형하고 동시에 $Mn^{2+}$ 농도 변화와 dGTP 불균형을 이용한 무작위 돌연변이 기법을 혼용하여 대장균에서 가용성 TMP-2 재조합 변이체를 생성하고자 하였다. 무작위로 재조합된 TIMP-2 유전자 중에서 가용성으로 발현되는 TIMP-2 유전자를 선별하기 위해서 chloramphenicol acetyltransferase (CAT)-융합 방법을 도입하였다. CAT 유전자가 가용성으로 발현되는 재조합 TIMP-2 유전자에 융합되면 이를 갖는 E. coli는 높은 chloramphenicol 환경에서 생존이 가능하게 된다. 이러한 in virro mutageuesis 기법과 CAT-융합 방법으로 대장균 가용성 TIMP-2 재조합 변이체를 14가지 얻을 수 있었다. 변이체 TIMP-2의 아미노산서열 분석과 구조 분석 결과 주로 소수성 아미노산이 친수성 아미노산으로 전환되었고, MMP와의 결합이 관여하지 않는 C-말단 부위에 돌연변이가 집중되어 있었다. 본 연구에서 개발된 간편하고 새로운 in vitro 재조합 방법과 CAT을 이용한 스크리닝 기법은 다른 많은 대장균 내 불가용성 단백질의 발현에도 사용될 수 있을 것으로 사료된다.
The second family member of tissue inhibitors of matrix metalloproteinases, TIMP-2, is a 21kDa protein which inhibits matrix metalloproteinases 2 (MMP-2). Expression of mammalian proteins in E. coli often forms inclusion bodies that are made up of mis-folded or insoluble protein aggregates. The requ...
The second family member of tissue inhibitors of matrix metalloproteinases, TIMP-2, is a 21kDa protein which inhibits matrix metalloproteinases 2 (MMP-2). Expression of mammalian proteins in E. coli often forms inclusion bodies that are made up of mis-folded or insoluble protein aggregates. The requirement for the formation of 6 disulfide bonds in the process of the TIMP-2 folding is likely to be incompatible with the reducing environment of E. coli. However, this incompatibility can be often overcome by introducing a mutagenesis that could lead to enhancement of the protein solubility. In this reason, we have attempted to express the soluble TIMP-2 in E. coli by applying a modified staggered extension process (StEP), one of the in vitro PCR-based recombinant mutagenesis methods, and error-prone PCR. C-terminally located CAT fusion protein with respect to mutated TIMP-2 proteins enables us to differentiate the soluble TIMP-2 from the insoluble in E. coli by virtue of chloramphenicol resistance. According to this scheme, E. coli harboring properly-folded CAT fused to TIMP-2 protein was selected, and some of the resulting colonies exhibited an enhanced, soluble expression of TIMP-2 compared to the wild type, implying (i) the StEP technique is successfully employed to enhance the proper folding thereby increasing the solubility of TIMP-2, and (ii) the CAT dependent screening may be a simple and effective method to differentiate the soluble protein expression in E. coli.
The second family member of tissue inhibitors of matrix metalloproteinases, TIMP-2, is a 21kDa protein which inhibits matrix metalloproteinases 2 (MMP-2). Expression of mammalian proteins in E. coli often forms inclusion bodies that are made up of mis-folded or insoluble protein aggregates. The requirement for the formation of 6 disulfide bonds in the process of the TIMP-2 folding is likely to be incompatible with the reducing environment of E. coli. However, this incompatibility can be often overcome by introducing a mutagenesis that could lead to enhancement of the protein solubility. In this reason, we have attempted to express the soluble TIMP-2 in E. coli by applying a modified staggered extension process (StEP), one of the in vitro PCR-based recombinant mutagenesis methods, and error-prone PCR. C-terminally located CAT fusion protein with respect to mutated TIMP-2 proteins enables us to differentiate the soluble TIMP-2 from the insoluble in E. coli by virtue of chloramphenicol resistance. According to this scheme, E. coli harboring properly-folded CAT fused to TIMP-2 protein was selected, and some of the resulting colonies exhibited an enhanced, soluble expression of TIMP-2 compared to the wild type, implying (i) the StEP technique is successfully employed to enhance the proper folding thereby increasing the solubility of TIMP-2, and (ii) the CAT dependent screening may be a simple and effective method to differentiate the soluble protein expression in E. coli.
* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.
문제 정의
본 연구의 목표는 유전자 셔플링의 변형된 형태인 StEP (staggered extension process)을 변형, 개량하여(33-34) TIMP-2 유전자 변이체를 생산하고, E. coli 내에서의 TIMP-2 단백질의 가용성 향상을 선별하기 위해 CAT (chloramphenicol acetyltransferase) 단백질과의 융합을 (35-37) 통해 가용성재조합 TIMP-2를 손쉽게 선별하는 새로운 방법을 개발하는 것이다. 본 방법은 장차 E.
그러나 StEP에 의한 재조합효율은 점돌연변이법이나 다른 PCR 기반 재조합 방법 및 기타 유전자 셔플링방법에 비하여 낮은 효율을 보인다(27). 본 연구에서는 StEP 기법을 변형하여 DNA 재조합 효율을 증가시키기 위한 새로운 시도를 하였다. 즉, 변형 StEP 재조합방법에서는 PCR 과정의 변성, 부착, 확장 시간을 최대한도로 단축하여 유전자 재조합 빈도를 증가시키고자 하였다.
본 연구에서는 대장균에서 불가용성으로 발현되는 TIMP-2 유전자를 유전자셔플링 기법의한 가지인 StEP (staggered extension process)를 변형하고 동시에 Mn2+ 농도 변화와 dGTP 불균형을 이용한 무작위 돌연변이 기법을 혼용하여 대장균에서 가용성 TIMP-2 재조합 변이체를 생성하고자 하였다. 무작위로 재조합된 TIMP-2 유전자 중에서 가용성으로 발현되는 TIMP-2 유전자를 선별하기 위해서 chloramphenicol acetyltransferase (CAT)-융합 방법을 도입하였다.
제안 방법
무작위로 재조합된 TIMP-2 유전자 중에서 가용성으로 발현되는 TIMP-2 유전자를 선별하기 위해서 chloramphenicol acetyltransferase (CAT)-융합 방법을 도입하였다. CAT 유전자가 가용성으로 발현되는 재조합 TIMP-2 유전자에 융합되면 이를 갖는 E.
9이상의 고 순도의 RNA만을 cDNA 합성에 사용하였다. 4~5 ng의 total RNA를 올리고 dT (18 염기)와 역전사효소 (Takara Shuzo, Ghiga, Japan)를 이용하여 cDNA를 합성하였다. CAT 유전자는 pBR325 백터에 들어있는 것을 서브클로닝하여 사용하였다.
CAT 유전자는 pBR325 백터에 들어있는 것을 서브클로닝하여 사용하였다. PCR 반응은 CAT 유전자나 사람 TIMP-2 유전자가 포함된 플라스미드 DNA 2.0 ill를 각각 DNA 주형으로 사용하여 여기에 10x pfu 완충액 2.0 pl, 2.5 mM MgCl2, dNTP 각각 2.5 mM, 프라이머 50 pM, 그리고 pfu DNA 중합효소 1U을 가하여 최종 부피가 20.0 μ1 되게 조절하여 수행하였다. 각각의 프라이머는 Primer3 (steve@genome.
포워드 프라이머가 S'-CCCAAGCTTCCC GGATGGAGAA-3' (밑줄은 Hind Ⅲ 제 한효소자리), 리버스 프라이머 가 5'- GGGCGGGGCGTAACTCGAGCGG3 (밑줄은 Xhol 제한효소 자리)이며, PCR 결과 예상되는 CAT의 크기는 670 bp이다. 사람 TIMP-2 cDNA 클로닝을 위한 PCR의 구성은 변성 (densturation) 94℃ 3분 1회; 변성 94℃ 30초 접합 (annealing) 54℃ 3(屋, 확장 (extension) 72℃ 3분 각 35회; 확장 72℃ 1분으로 구성되었다. CAT cDNA 서브클로닝을 위한 PCR의 구성은 변성 94℃ 3분 1회; 변성 94℃ 30초 접합 56℃ 30초, 확장 72℃ 3분 각 35회; 확장 72℃ 1분으로 구성되었다.
사람 TIMP-2 cDNA 클로닝을 위한 PCR의 구성은 변성 (densturation) 94℃ 3분 1회; 변성 94℃ 30초 접합 (annealing) 54℃ 3(屋, 확장 (extension) 72℃ 3분 각 35회; 확장 72℃ 1분으로 구성되었다. CAT cDNA 서브클로닝을 위한 PCR의 구성은 변성 94℃ 3분 1회; 변성 94℃ 30초 접합 56℃ 30초, 확장 72℃ 3분 각 35회; 확장 72℃ 1분으로 구성되었다. 각각의 PCR 반웅물을 1% 아가로스젤 상에서 전기영동하여 크기를 확인한 후, 모든 반응물을 1.
CAT cDNA 서브클로닝을 위한 PCR의 구성은 변성 94℃ 3분 1회; 변성 94℃ 30초 접합 56℃ 30초, 확장 72℃ 3분 각 35회; 확장 72℃ 1분으로 구성되었다. 각각의 PCR 반웅물을 1% 아가로스젤 상에서 전기영동하여 크기를 확인한 후, 모든 반응물을 1.5% 아가로스젤 상에서 전기영동 후 원하는 DNA 조각을 잘라내어 QIAEX II 젤추출키트 (Qiagen, Valencia, CA)를 이용하여 순수 분리하였다. 분리되어 얻어진 TIMP-2와 CAT DNA를 각각 Nde디Sac、HindUl/XhoI 제한효소 처리한 후, 같은 제한효소가 처리된 E.
5% 아가로스젤 상에서 전기영동 후 원하는 DNA 조각을 잘라내어 QIAEX II 젤추출키트 (Qiagen, Valencia, CA)를 이용하여 순수 분리하였다. 분리되어 얻어진 TIMP-2와 CAT DNA를 각각 Nde디Sac、HindUl/XhoI 제한효소 처리한 후, 같은 제한효소가 처리된 E. coli 발현 벡터인 pET30a(+) (Novagen, Madison, WI)에 각각 삽입하였다.
TIMP-2 돌연변이체 라이브러리의 생산은 error-prone PCR 방법 (잉여의 Mn*와 dGTP 첨가)(17)과 StEP 방법(21)을 변형, 조합하여 수행하였다. 250.
0 Unit Taq DNA 중합효소 (Roche, Penzberg, GER)를 넣고 최종 부피가 30 μ1이 되게 증류수로 채워 수행하였다. StEP 재조합 PCRe Eppendorf Mastercycler EPgradientS (Eppendrf, Hamburg, GER)을 사용하여, 변성 941: 3분 1회; 변성과 부착 94℃ 5초, 54℃ 5초 각 100회; 확장 72℃ 5분으로 수행하였다. 재조합된 650 bp 크기의 TIMP-2 DNA를 1% 아가로스젤상에서 전기영동하여 확인하였고, 해당 DNA 밴드를 잘라내어 Ndel/Sacl 제한효소 처리하여 분리한 후, CAT 유전자가 이미 삽입되어 있는 pET 30a(+) 벡터의 CAT 유전자 N-말단에 삽입하였다.
StEP 재조합 PCRe Eppendorf Mastercycler EPgradientS (Eppendrf, Hamburg, GER)을 사용하여, 변성 941: 3분 1회; 변성과 부착 94℃ 5초, 54℃ 5초 각 100회; 확장 72℃ 5분으로 수행하였다. 재조합된 650 bp 크기의 TIMP-2 DNA를 1% 아가로스젤상에서 전기영동하여 확인하였고, 해당 DNA 밴드를 잘라내어 Ndel/Sacl 제한효소 처리하여 분리한 후, CAT 유전자가 이미 삽입되어 있는 pET 30a(+) 벡터의 CAT 유전자 N-말단에 삽입하였다. 재조합된 TIMP-2 벡터는 E.
재조합된 650 bp 크기의 TIMP-2 DNA를 1% 아가로스젤상에서 전기영동하여 확인하였고, 해당 DNA 밴드를 잘라내어 Ndel/Sacl 제한효소 처리하여 분리한 후, CAT 유전자가 이미 삽입되어 있는 pET 30a(+) 벡터의 CAT 유전자 N-말단에 삽입하였다. 재조합된 TIMP-2 벡터는 E. coli 균주 NOVABLUE (DE3) (Novagen, Darstadt, GER)에 도입, 형질 전환하여 변이체 라이브러리를 제작하였다.
재조합 돌연변이 반응이 일어났는지 확인하기 위하여 Taq] PCR Fidelity Assay (Clontech, Palo Alto, CA)를 병 행하여 수행하였다. 이 에세이에서는 Taql 제한효소의 인식서열인 TCGA 중 한 개가 빠져있는 pseudo-Taql 서열이 재조합 과정에서 증폭되면서 몇몇의 pseudo-서열이 Taql 제한효소 서열로 전환될 것으로 예상된다.
이 에세이에서는 Taql 제한효소의 인식서열인 TCGA 중 한 개가 빠져있는 pseudo-Taql 서열이 재조합 과정에서 증폭되면서 몇몇의 pseudo-서열이 Taql 제한효소 서열로 전환될 것으로 예상된다. 재조합 PCR 반응이 완료된 후, 반응물을 Taql 제한효소 처리하여 돌연변이에 의한 Taql 부위의 생성 여부를 확인하였다.
변형된 StEP 재조합 방법과 error-prone PCR 방법의 혼용으로 생성된 TIMP-2 변이체 중에서 E. coli 가용성 TIMP-2를 선별하기 위하여 CAT 단백질과의 융합에 의한 선별을 이용하였다(33). 변이체 TIMP-2 유전자를 CAT 유전자와 융합하여 E.
coli 가용성 TIMP-2를 선별하기 위하여 CAT 단백질과의 융합에 의한 선별을 이용하였다(33). 변이체 TIMP-2 유전자를 CAT 유전자와 융합하여 E. coli 라이브러리를 Novablue (DE3) E. coli 균주로 제작하였다. 라이브러리 콜로니들을 kanamycin 50.
coli 균주로 제작하였다. 라이브러리 콜로니들을 kanamycin 50.0 “g/ml을 포함한 LB 배지 3.0 ml에 37℃에서 180 rpm으로 교반 하면서 하룻밤 동안 배양한 후 각각의 콜로니를 34, 68, 102 “g/ml 의 chloramphenicol이 포함된 LB 플레이트 상에서 37℃에서 16시간 동안 배양하였다. 다음으로 재조합 TIMP-2/CAT 융합단백질의 발현을 유도하기 위해 상기 농도의 chloramphenicol이 함유된 LB 플레이트에서 생존한 E.
0 ml에 37℃에서 180 rpm으로 교반 하면서 하룻밤 동안 배양한 후 각각의 콜로니를 34, 68, 102 “g/ml 의 chloramphenicol이 포함된 LB 플레이트 상에서 37℃에서 16시간 동안 배양하였다. 다음으로 재조합 TIMP-2/CAT 융합단백질의 발현을 유도하기 위해 상기 농도의 chloramphenicol이 함유된 LB 플레이트에서 생존한 E. coli 콜로니만을 선택하여, 34.0 fl리ml chloramphenicol이 포함된 2xYT 배지에서 37℃, 180 rpm 속도로 OD«» 값이 0.6에 도달할 때까지 배양하였다. 흡광도 값이 0.
6에 도달하면 배양액을 얼음 위에서 5분 동안 정치한 후, 4, 000 rpm의 속도로 4℃에서 10분 동안 원심분리하여 배지를 제거하였다. IPTG (isopropyl thio-p -D-galactoside) 0.4 mM과 포도당 l%(w/v)가 포함된 2xYT 배지로 재혼탁하여 30笆에서 3시간 동안 배양하면서 E. coli 에서 TIMP-2/CAT 융합단백질의 발현을 유도하였다. 배양액을 다시 위와 동일한 조건으로 원심분리한 후, 침전된 균주를 10 您 라이소자임과 10 ill protease inhibitor cocktail set (Calbiochem, La Jolla, CA)이 포함된 0.
SDS-PAGE는 5% 아크릴아마이드 농도의 축절 젤, 10% 아크릴아마이드 농도의 분리 겔을 사용하여 수행하였다. SDS-PAGE 수행 후, 니트로셀룰로스 블로팅막 (Sartorius, Gottingen, Germany) 으로 135 mA에서 1.
SDS-PAGE 수행 후, 니트로셀룰로스 블로팅막 (Sartorius, Gottingen, Germany) 으로 135 mA에서 1.5시간 동안 단백질을 이동하였다. 블로팅막을 5% (v/v) 무지방 분유, 0.
5시간 동안 단백질을 이동하였다. 블로팅막을 5% (v/v) 무지방 분유, 0.01% (w/v) antifoam A, 0.02% (w/v) sodium azide가 함유된 PBS 차단용액에 1시간 동안 처리한 훅, 1:1,000 으로 희석된 토끼의 항-hTIMP-2 항체 (Smta Cruz Biotech, Santa Cruz, CA)로 1차 반응하였고, 1:3, 000로 희석된 토끼의 퍼옥시다제와 결합된 항-IgG 항체 (Santa Cruz Biotech) 로 2차 처리하고 Western blotting luminol reagent (Santa Cruz Biotech)로 발색하여 확인하였다.
(Daejeon, Koea)에 의뢰하여 수행하였다. 얻어진 DNA 서열을 NCBI BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) 를 이용하여 정렬하였고, 아미노산 서열분석을 위하여 EXPASY 틀 (http://expasy.org/tools/) 및 CLUSTALW 1.83 (Windows version, European Bioinformatics Institute, available at http:// www.ebi.ac.uk/clustalw)을 이용하였다. 얻어진 아미노산 서열을 바탕으로 야생형 TIMR2와 돌연변이체 TIMP-2의 3차원 구조를 Geno3D (http://geno3d-pbil.
uk/clustalw)을 이용하였다. 얻어진 아미노산 서열을 바탕으로 야생형 TIMR2와 돌연변이체 TIMP-2의 3차원 구조를 Geno3D (http://geno3d-pbil.ibcp.fr)를 바탕으로 모델링하여 비교하였다.
본 연구에서는 StEP 기법을 변형하여 DNA 재조합 효율을 증가시키기 위한 새로운 시도를 하였다. 즉, 변형 StEP 재조합방법에서는 PCR 과정의 변성, 부착, 확장 시간을 최대한도로 단축하여 유전자 재조합 빈도를 증가시키고자 하였다. 또한 error-prone PCR 방법을 도입, 혼용하여 PCR 반응액에 잉여의 Mn2+ 첨가와 dNTP 농도의 불균형을 인위적으로 만들어 A:T-»T:A, A:T-G:C, 그리고 G:C-A:T 형태로 치환이 유도되도록 하였다(17).
즉, 변형 StEP 재조합방법에서는 PCR 과정의 변성, 부착, 확장 시간을 최대한도로 단축하여 유전자 재조합 빈도를 증가시키고자 하였다. 또한 error-prone PCR 방법을 도입, 혼용하여 PCR 반응액에 잉여의 Mn2+ 첨가와 dNTP 농도의 불균형을 인위적으로 만들어 A:T-»T:A, A:T-G:C, 그리고 G:C-A:T 형태로 치환이 유도되도록 하였다(17). 다음으로, 이와 같은 방법으로 제작된 변이 체 라이브러리를 고속검색하기위해 CAT 유전자와 변이 체 DNA의 융합을 통해 E.
또한 error-prone PCR 방법을 도입, 혼용하여 PCR 반응액에 잉여의 Mn2+ 첨가와 dNTP 농도의 불균형을 인위적으로 만들어 A:T-»T:A, A:T-G:C, 그리고 G:C-A:T 형태로 치환이 유도되도록 하였다(17). 다음으로, 이와 같은 방법으로 제작된 변이 체 라이브러리를 고속검색하기위해 CAT 유전자와 변이 체 DNA의 융합을 통해 E. c湖의 chloramphenicol 저항성에 기반을 둔 변이체 선별 방법을 시도하였다(Fig. 1).
사람 TIMP-2 cDNA를 자궁내막 조직으로부터 PCR 방법으로 클로닝하여 650 bp 크기의 cDNA를 확인하였고(Fig. 2A), 이 DNA를 주형으로 error-prone PCR 방법이 혼용된 개량 StEP 재조합 방법을 이용하여 in vitro 재조합을 수행하였다. In vitro 재조합 결과 생성된 반응물을 1% 아가 로스 젤 상에서 전기영동으로 분리, 확인하였다(Rg.
2B). 650 bp 크기의 재조합 TIMP-2 cDNA를 아가로스 젤로부터 분리, 정제하여 제한효소 Ndel과 Sad 처리를 한 후에 E. coli 발현 벡터인 pET30a (+)의 CAT 유전자의 N-말단에 삽입하여 CAT 유전자와 융합시켰다.
한편, in vitro 재조합에 의한 돌연변이 반응이 제대로 일어나는지 확인하기 위하여 Taql PCR fidelity assay를 병행으로 수행하였다. 무작위 돌연변이가 생성된다면 TCGT, TCGG, TCGC 서열이 포함된 주형 DNA는 무작위적으로 TCGA로 교체되어 TaqI 제한효소에 의해 잘리게 된다.
융합 방법을 사용하였다. 야생형이나 재조합 TIMP-2 유전자를 pET30a (+) 벡터에 이미 삽입되어 있는 CAT 유전자의 N-말단에 삽입하여 TIMP-2-CAT 융합단백질이 만들어지게 제작하였다. E.
NOVABLUE (DE3) E. coli 균주에 재조합 TIMP-2/CAT 유전자를 도입하여 형질전환시켰고, 형질전환된 E. c 湖를 일차로 kanamycin 저항성에 근거하여 선별한 후, 선별된 집락을 고농도의 chloramphenicol°] 함유된 한천배지에 접종하였다. 34, 68, 102 "g/nil 농도의 chloramphenicol 존재 하에서 생장 상태가 양호한 59가지 E coli 집락을 선별하였다(Fig.
Chloramphenicol 저항성을 보이는 E. coli 집락만을 다시 0.4 mM의 IPTG가 함유된 배지에서 배양하여 TIMP-2/CAT 융합 단백질 발현을 유도하였다. 발현 유도 후에 각 E.
4 mM의 IPTG가 함유된 배지에서 배양하여 TIMP-2/CAT 융합 단백질 발현을 유도하였다. 발현 유도 후에 각 E. coli 세포 추출물의 상충액을 모아 SDS-PAGE로 분리하였다. 48kDa 크기의 재조합 TIMP-2/CAT 융합 단백질을 SDS-PAGE와 웨스턴 블로팅으로 확인하였다.
coli 세포 추출물의 상충액을 모아 SDS-PAGE로 분리하였다. 48kDa 크기의 재조합 TIMP-2/CAT 융합 단백질을 SDS-PAGE와 웨스턴 블로팅으로 확인하였다. 야생형 TIMP-2/CAT와 재조합 TIMP-2/CAT을 비교하면 재조합 TIMP-2/CAT 단백질이 더 가용성을 띠어 발현량이 증가됨을 확인할 수 있다Fig.
또한, N-말단 부위에서 시스테인 1번-시스테인 74번간의 이황화 결합과 시스테인 3번-시스테인 104번간의 이황화결합이 5개의 P-평면을 둘러싸고 형성되었고 C말단에서 2개의 0-평면과 1개의 a-나선이 형성되었다. 돌연변이 TIMP-2의 대표로 #60 TimR2의 구조를 비교하였다. N-말단의 경우 야생형 TIMP-2 의 3차구조와 유사한 구조로 1개의 a-나선과 1개의 μ-평면이 형성되었으나, C-말단에서는 1개의 a-나선과 3개의 0-평면이 형성되어 야생형 C-말단과 다른 구조를 보였다(Fig.
그 이유는 단백질 활성에 필수적인 정확한 접힘과 이에 따른 단백질 구조결정에 있어서 이황화결합의 형성 및 당질화가 중요한 역할을 하기 때문이다. 인간의 TIMP-2는 당질화가 불필요한 단백질이기 때문에 본 연구에서는 간편하고 저비용의 원핵세포 시스템을 이용하여 과발현을 시도하였다. 그러나 TIMP-2는 12개의 시스테인을 갖고 있고 다수의 이황화결합이 형성된다.
단백질 과 발현 시높은 단백질 농도에서 아미노산 사슬의 안쪽, 바깥쪽에서 무작위 결합이 일어날 수 있기 때문에 원핵세포에서 정확하지 않은 이황화결합이 일어날 수 있다. 이러한 문제를 피하기 위해, 개량된 StEP 기법과 error-prone PCR 방법을 혼용하여 TIMP-2 단백질이 E c泌에서 정확하게 접히고, 가용성의 성질을 갖도록 개량하였다.
c湖에서 chloramphenicol 저항성에 근거하여 가용성 단백질을 간편하게 선별할 수 있게 한다. 본 연구에서는 불가용성 TIMP-2 단백질을 가용성으로 전환시켜 이를 선별하는데 이용하였다. TIMP-2 변이체 단백질을 인코딩하는 유전자를 CAT 유전자와 융합하여 E.
coli 균주에 삽입하여 변이체 라이브러리를 제작하였다. 변이체 라이브러리 중고농도 chloramphenicol 환경에서 생존하는 E coli 만을 선별하여 가용성 TIMP-2 단백질의 발현을 확인하였다. 이러한 CAT 융합 선별법은 E c沥.
본 연구에서는 불가용성 TIMP-2 단백질을 가용성으로 전환시켜 이를 선별하는데 이용하였다. TIMP-2 변이체 단백질을 인코딩하는 유전자를 CAT 유전자와 융합하여 E. coli 발현 벡터인 pET30a (+)에 삽입한 후, 이를 E. coli 균주에 삽입하여 변이체 라이브러리를 제작하였다. 변이체 라이브러리 중고농도 chloramphenicol 환경에서 생존하는 E coli 만을 선별하여 가용성 TIMP-2 단백질의 발현을 확인하였다.
대상 데이터
TIMP-2 cDNA 클로닝에 사용할 RNA는 사람의 자궁내막 세포에서 RNA sol B (Biotech Lab, Houston, TX)를 이용하여 추출하였다. 흡광도 260 nm~280 nm에서 1.
흡광도 260 nm~280 nm에서 1.9이상의 고 순도의 RNA만을 cDNA 합성에 사용하였다. 4~5 ng의 total RNA를 올리고 dT (18 염기)와 역전사효소 (Takara Shuzo, Ghiga, Japan)를 이용하여 cDNA를 합성하였다.
4~5 ng의 total RNA를 올리고 dT (18 염기)와 역전사효소 (Takara Shuzo, Ghiga, Japan)를 이용하여 cDNA를 합성하였다. CAT 유전자는 pBR325 백터에 들어있는 것을 서브클로닝하여 사용하였다. PCR 반응은 CAT 유전자나 사람 TIMP-2 유전자가 포함된 플라스미드 DNA 2.
c 湖를 일차로 kanamycin 저항성에 근거하여 선별한 후, 선별된 집락을 고농도의 chloramphenicol°] 함유된 한천배지에 접종하였다. 34, 68, 102 "g/nil 농도의 chloramphenicol 존재 하에서 생장 상태가 양호한 59가지 E coli 집락을 선별하였다(Fig. 3A).
The number of mutations in recombinant TIMP-2s. 14 E. coli colonies (#3 to #175) were selected, and the resulting TIMP-2 cDNAs were purified and subjected to nucleotide sequencing. The amino acid sequences were deduced by EXPASY tools on PC
야생형 TIMP-2와 재조합 TIMP-2의 3차구조를 Geno3D 소프트웨어 (available at http://geno3d-pbil.ibcp.fr)■& 이용하여 분석하였다. 야생형 TIMP-2는 쐐기구조를 나타낸다.
이론/모형
야생형 및 돌연변이체 TIMP-2 DNA의 염기서열 분석은 제노텍 (Daejeon, Koea)에 의뢰하여 수행하였다. 얻어진 DNA 서열을 NCBI BLAST (http://www.
개량 StEP 방법으로 제작된 TIMP-2 돌연변이체 중, E coli 에서 가용성인 재조합 TIMP-2를 대량고속선별하기 위하여 CAT 융합 방법을 사용하였다. 야생형이나 재조합 TIMP-2 유전자를 pET30a (+) 벡터에 이미 삽입되어 있는 CAT 유전자의 N-말단에 삽입하여 TIMP-2-CAT 융합단백질이 만들어지게 제작하였다.
성능/효과
2A), 이 DNA를 주형으로 error-prone PCR 방법이 혼용된 개량 StEP 재조합 방법을 이용하여 in vitro 재조합을 수행하였다. In vitro 재조합 결과 생성된 반응물을 1% 아가 로스 젤 상에서 전기영동으로 분리, 확인하였다(Rg. 2B). 650 bp 크기의 재조합 TIMP-2 cDNA를 아가로스 젤로부터 분리, 정제하여 제한효소 Ndel과 Sad 처리를 한 후에 E.
무작위 돌연변이가 생성된다면 TCGT, TCGG, TCGC 서열이 포함된 주형 DNA는 무작위적으로 TCGA로 교체되어 TaqI 제한효소에 의해 잘리게 된다. PCR 반옹이 끝난 후 산물에 TaqI 제한효소 자리가 생성됨을 확인하였다(Fig. 3C).
48kDa 크기의 재조합 TIMP-2/CAT 융합 단백질을 SDS-PAGE와 웨스턴 블로팅으로 확인하였다. 야생형 TIMP-2/CAT와 재조합 TIMP-2/CAT을 비교하면 재조합 TIMP-2/CAT 단백질이 더 가용성을 띠어 발현량이 증가됨을 확인할 수 있다Fig. 3B, Q.
정량적으로 분석해 보면, chloramphenicol 저항성을 이용하여 재조합 TIMP-2 유전자 라이브러리 중 59개의 콜로니가 1차로 선별되었으며, 이 중 14개 콜로니에서 48kDa 크기의 과발현된 TIMP-2/CAT 융합단백질을 확인할 수 있었다. 기대했던 대로, 야생형 TIMP-2/CAT 융합단백질은 봉입체 형태로 존재하여 용해성 형태의 단백질 발현이 매우 미약하였다.
가용성 발현이 확인된 14가지의 재조합 TIMP-2는 적게는 1개에서 많게는 12개의 아미노산 치환이 관찰되었다. 재조합 TIMP-2의 N-말단 부분 (MMP 억제부위)에서는 0에서 5개의 아미노산 치환이 일어났고, C-말단 부분에서는 1 에서 9개의 아미노산 치환이 일어났다.
관찰되었다. 재조합 TIMP-2의 N-말단 부분 (MMP 억제부위)에서는 0에서 5개의 아미노산 치환이 일어났고, C-말단 부분에서는 1 에서 9개의 아미노산 치환이 일어났다. 특히, #60 콜로니에서는 22개의 DNA 염기서열치환 및, 14개의 아미노산 치환이 일어났으며, #75 콜로니에서는 17개의 DNA 염기 치환과 12개의 아미노산 치환이 일어났다.
(19-20). 본 연구에서 사용한 변형 StEP 방법으로 유도된 TIMP-2에서 점돌연변이의 수는 평균적으로 12개/1,000 bp 를 보였다(Table 1).
coli colonies (#3 to #175) were selected, and the resulting TIMP-2 cDNAs were purified and subjected to nucleotide sequencing. The amino acid sequences were deduced by EXPASY tools on PC
CLUSTALW 1.83 (Windows version, European Bioinformatics Institute, available at http://www.ebi.ac.uk/clus組Iw)을 이용하여 염기서열과 아미노산서열을 비교, 분석한 결과, 가용성 재조합 TIMP-2에서는 주로 소수성 아미노산이 친수성 아미노산으로 치환되는 경향을 보였다(Fig. 4)
.
5). 따라서, 구조적으로도 MMP와 결합 부위를 제공하는 N-말단이 잘 보존되어 있음을 확인하였다.
결론적으로 많은 주요한 단백질은 E c湖에서 정확한 접힘과 이에 따른 가용성의 증가가 효과적이지 못해 과 발현이 되지 못한다. 본 연구에 개발된 변형 StEP 방법과 CAT 융합선별법은 비가용성 단백질을 매우 효과적으로 원핵세포에서 과발현시키는 방법을 제공한다고 사료된다.
이러한 in vitro mutagenesis 기법과 CAT-융합 방법으로 대장균 가용성 TIMP-2 재조합 변이체를 14가지 얻을 수 있었다. 변이체 TIMP-2의 아미노산서열 분석과 구조 분석 결과 주로 소수성 아미노산이 친수성 아미노산으로 전환되었고, MMS와의 결합이 관여하지 않는 C-말단 부위에 돌연변이가 집중되어 있었다.
변이체 TIMP-2의 아미노산서열 분석과 구조 분석 결과 주로 소수성 아미노산이 친수성 아미노산으로 전환되었고, MMS와의 결합이 관여하지 않는 C-말단 부위에 돌연변이가 집중되어 있었다. 본 연구에서 개발된 간편하고 새로운 in vitro 재조합 방법과 CAT을 이용한 스크리닝 기법은 다른 많은 대장균 내 불가용성 단백질의 발현에도 사용될 수 있을 것으로 사료된다.
후속연구
변이체 TIMP-2의 아미노산서열 분석과 구조 분석 결과 주로 소수성 아미노산이 친수성 아미노산으로 전환되었고, MMS와의 결합이 관여하지 않는 C-말단 부위에 돌연변이가 집중되어 있었다. 본 연구에서 개발된 간편하고 새로운 in vitro 재조합 방법과 CAT을 이용한 스크리닝 기법은 다른 많은 대장균 내 불가용성 단백질의 발현에도 사용될 수 있을 것으로 사료된다.
coli 내에서의 TIMP-2 단백질의 가용성 향상을 선별하기 위해 CAT (chloramphenicol acetyltransferase) 단백질과의 융합을 (35-37) 통해 가용성재조합 TIMP-2를 손쉽게 선별하는 새로운 방법을 개발하는 것이다. 본 방법은 장차 E. c*에서 봉입체 형성으로 낮은 가용성을 보이는 외래 단백질의 과 발현에 응용될 것이다.
못한다. 본 연구에 개발된 변형 StEP 방법과 CAT 융합선별법은 비가용성 단백질을 매우 효과적으로 원핵세포에서 과발현시키는 방법을 제공한다고 사료된다.
참고문헌 (37)
Butler, G. S., M. Hutton, B. A Wattam, F. Willenbrock, and G. Murphy (1999), The specificity of TIMP-2 for matrix metalloproteinases can be modified by single amino acid mutations. J. BioI. Chem. 274, 20391-20396
Maquoi, E., F. Frankenne, E. Baramova, C. Munaut, N. E. Sounni, A. Remacle, A. Noel, G. Murphy, and J.-M. Foidart (2000), Membrane type-1 matrix metalloproteinase-associated degradation of tissue inhibitor of metalloproteinase 2 in human tumor cell line. J. Biol. Chem. 276, 11368-11378
Park, Y. H., H. S. Ryu, D. S. Choi, K. H. Chang, D. W. Park, and C. K. Min (2003), Effects of hepatocyte growth factor on the expression of matrix metalloproteinases and their tissue inhibitors during the endometrial cancer invasion in a three-dimensional coculture. Int. J. Gynecol. Cancer 13, 53-60
Stetler-Stevenson, W. G., S. Aznavoorian, and L. A Liotta (1993), Tumor cell interactions with the extracellular matrix during invasion and metastasis. Annu. Rev. Cell BioI. 9, 541-573
Itoh, T., M. Tanioka, H. Matsuda, H. Nishimoto, T. Yoshioka, R. Suzuki, and M. Uehira (1999), Experimental metastasis is suppressed in MMP-9-deficient mice. Clin. Exp. Metastasis 17, 177-181
Hernandez-Barrantes, S., M. Toth, M. M. Bernardo, M. Yurkova, D. C. Gervasi, Y. Raz, Q. A. Sang, R. Fridman (2000), Binding of active (57 kDa) membrane type 1-matrix metalloproteinase (MT1-MMP) to tissue inhibitor of metalloproteinase (TlMP)-2 regulates MT1-MMP processing and pro-MMP-2 activation. J. BioI. Chem. 275, 12080-12089
Frederick, W. M., A. F. Tom, F. James, B. F. Robert, D. C. Mark, and A. W. Richard (1998), High resolution structure of the N-terminal domain of tissue inhibitor of metalloproteinases-2 and characterization of its interaction site with matrix metalloproteinases-3. J. BioI. Chem. 273, 21736-21743
Fassina, G., N. Ferrari, C. Brigati, R. Benelli, L. Santi, D. M. Noonan, and A. Albini (2000), Tissue inhibitors of metalloproteinases: regulation and biological activities. Clin. Exp. Metastasis 18, 111-120
McDonnell, S., V. Chaudhry, J. Mansilla-Soto, Z. S. Zeng, W. Shu, and J. G. Guillem (1999), Metastatic and non-metastatic colorectal cancer (CRC) cells induce host metalloproteinase production in vivo. Clin. Exp. Metastasis 17, 341-349
Boyd, R. S., and F. R. Balkwill (1999), MMP-2 release and activation in ovarian carcinoma: the role of fibroblasts. Br. J. Cancer 80, 315-321
Westerlund, A., P. U. Hujanen, and T. Turpeenniemi-Hujanen (1997), Fibroblasts srimulate human ovarian cancer cell invasion and expression of 72-kDa gelatinase A (MMP-2). Gynecol. Oncol. 67, 76-82
Baker, A. H., D. R. Edwaro;, and G. Murphy (2002), Metalloproteinase inhibitors: biological actions and therapeutic opportunities. J. Cell Sci. 115, 3719-3727
Negro, A., M. Onisto, L. Masiero, and S. Garbisa (1995), Synthesis and refolding of human TIMP-2 from E coli, with specific activity for MMP-2. FEBS Lett. 360, 52-56
Williamson, R. A. (2001), Refolding of TIMP-2 from Escherichia coli inclusion bodies. Methods Mol. BioI. 151, 257-265
Cochran, J. R., C. Y. Kim, S. M. Lippow, B. Rao, and K. D. Wittrup (2006), Improved mutants from directed evolution are biased to orthologous substitutions. Protein Eng. Des. Sel. 19, 245-253
Kamiya, H., M. Ito, and H. Harashirna (2007), Induction of various mutations during PCRs with manganese and 8-hydroxy-dGTP. BioI. Pharm. Bull. 4, 842-844
Kawate, H., D. M. Landis, and L. Loeb (2002), Distribution of mutations in human thymidylate syntltase yielding resistance to 5-fluorodeoxyuridine. J. BioI. Chem. 277, 36304-36311
Zhao, H., L. Giver, Z. Shao, J. A. Affholter, and F. H. Arnold (1998), Molecular evolution by staggered extension process (StEP) in vitro recombination. Nat. Biotech. 16, 258-261
Crameri, A., S. Raillard, E. Bermudez, W. P. Stemmer (1998), DNA shuffling of a family of genes from diverse species accelerates directed evolution. Nature 391, 288-291
Stemmer, W. P. (1994), DNA shuffling by random fragmentation and reassembly: In vitro recombirtation for molecular evolution. Proc. Natl. Acad. Sci. USA 91, 10747-10751
Zhang, J. H., G. Dawes, and W. P. Stemmer (1997), Directed evolution of a fucosidase from a galactosidase by DNA shuffling and screening. Proc. Natl. Acad. Sci. USA 94, 4504-4509
Aguinaldo, A. M., and F. Arnold (2003), Staggered extension process (StEP) in vitro recombination. Methods Mol. Biol. 192, 105-110
Zhao, H. and F. Arnold (1999), Directed evolution converts subtilisin E into a functional equivalent of thermitase. Protein Engineering 12, 47-53
Miyazaki, K., P. L. Wintrode, R. A. Grayling, D. N. Rubingh, and F. Arnold (2000), Directed evolution study of temperature adaptation in a psychrophilic enzyme. J. Mol. Biol. 297, 1015-1026
Jermutus, L., A. Honegger, F. Schwesinger, J. Hanes, and A. Pluckthun (2001), Tailoring in vitro evolution for protein affmily or stability. Proc. Natl. Acad. Sci. USA 94, 4504-4509
Waldo, G. S., B. M. Standish, J. Berendzen, and T. C. Terwilliger (1999), Rapid protein folding assay using green fluorescent protein. Nat. Biotech. 17, 691-695
Altamirao, M. M., J. M. Blackburn, C. Aguayo, and A. R. Fersht (2000), Directed evolution of new catalytic activity using the alphafbeta-barrel scaffold. Nature 403, 617-622
Shao, Z., H. Zhao, L. Giver, and F. H. Arnold (1997), Randompriming in vitro recombination: an effective tool for directed evolution. Nucleic Acids. Res. 26, 681-683
Lesley, S. A., J. Graziano, C. Y. Cho, M. W. Knuth, H. E. Klock (2002), Gene expression response to misfolded protein as a screen for soluble recombinant protein. Protein engineering 15, 153-160
Maxwell, K. L., A. K. Mittermaier, J. D. Forman-Kay, and A. R. Davidson (1999), A simple in vivo assay for increased protein solubility. Protein Sci. 8, 1908-1911
※ AI-Helper는 부적절한 답변을 할 수 있습니다.