선택한 단어 수는 입니다.
최소 단어 이상 선택하여야 합니다.
최소 단어 이상 선택하여야 합니다.
선택한 단어 수는 30입니다.
최대 10 단어까지만 선택 가능합니다.
최대 10 단어까지만 선택 가능합니다.
제안 방법
- The purpose of this study was to use annealing control primer‐based reverse transcription polymerase chain reaction (ACP RT‐PCR), and quantitative real‐time PCR (qRT‐PCR) to determine the differential expression of genes and to sequence isolated genes in the miniature pig ovary during pregnancy.
- We designed primers in conserved regions from expressed sequence tag (EST) sequences, and PCR was carried out using the Takara LA Taq Polymerase kit and 10 pmol of both forward and reverse primers, as per the manufacturer’s instructions (Takara).
- Differentially expressed bands were extracted from the gel by using the GENECLEAN II Kit (Q‐BIO gene, Carlsbad, CA, USA), and were directly cloned into a TOPO TA cloning vector (Invitrogen, Carlsbad, CA, USA), according to the manufacturerʹs instructions. The cloned plasmids were sequenced with an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA), using an M13 forward primer (5ʹ‐CGCCAGGGTTTTCCCAGTCACGA‐3ʹ) and M13 reverse primer (5ʹ‐AGCGGATAACAATTTCACACAGGA‐3ʹ).
- Differentially expressed bands were extracted from the gel by using the GENECLEAN II Kit (Q‐BIO gene, Carlsbad, CA, USA), and were directly cloned into a TOPO TA cloning vector (Invitrogen, Carlsbad, CA, USA), according to the manufacturerʹs instructions. The cloned plasmids were sequenced with an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA), using an M13 forward primer (5ʹ‐CGCCAGGGTTTTCCCAGTCACGA‐3ʹ) and M13 reverse primer (5ʹ‐AGCGGATAACAATTTCACACAGGA‐3ʹ).
- To identify DEGs in the ovary at different stages of pregnancy, we performed ACP RT‐PCR analysis using a combination of 120 arbitrary ACP primers and 2 oligo dT primers (dT‐ACP1 and dT‐ACP2). From the analysis, we selected 13 PCR products showing differential expression on the basis of pregnancy status.
- In this study, we isolated novel and unknown cDNA differentially expressed in the ovary tissue of miniature pigs at day 0 (non‐pregnancy), 30, and 60 of gestation. Miniature pig ovary was taken additionally on day 110 of the pregnancy to perform real‐time RT‐PCR analysis.
- In this study, we isolated novel and unknown cDNA differentially expressed in the ovary tissue of miniature pigs at day 0 (non‐pregnancy), 30, and 60 of gestation. Miniature pig ovary was taken additionally on day 110 of the pregnancy to perform real‐time RT‐PCR analysis. Using ACP RT‐PCR, we identified 13 genes that were differentially expressed depending on pregnancy status (Fig.
대상 데이터
- com) and whit‐colored 384‐well plates (ABgene, Hamburg, Germany) for intensification of the fluorescent signals by a factor of 3. The system operates using a thermal cycler and a laser that is directed via fiber optics to each of the 384 sample wells. The fluorescenceemission from each sample was collected by a charge‐coupled device‐camera, and the quantitative data were analyzed using the Sequence Detection System software (SDS version 2.
이론/모형
- Differentially expressed genes were screened by an ACP‐based PCR method (Kim et al., 2004) using the GeneFishing differentially expressed gene (DEG) kits (Seegene, Seoul, South Korea). Briefly, second‐strand cDNA-synthesis was conducted at 50℃ during one cycle of first‐stage PCR in a final reaction volume of 20 μl containing 3～5 μl(about 50 ng) of diluted first‐strand cDNA, 1 μl of dT‐ACP2 (10 μM), 1 μl of 10μM arbitrary ACP, and 10 μl of 2×Master Mix (Seegene).
※ AI-Helper는 부적절한 답변을 할 수 있습니다.