THP-1 Cell과 HUVEC을 이용한 Co-Culture Model System에서 최종당화산물에 의한 Cytokines와 RAGE 발현 Co-Culture Model Using THP-1 Cell and HUVEC on AGEs-Induced Expression of Cytokines and RAGE원문보기
Glyceraldehyde를 이용하여 제조된 AGEs 화합물(glycer-AGEs)을 단구세포인 THP-1, 혈관내피세포인 HUVEC 및 이 두 세포가 동시에 배양된 system에서 100 ${\mu}g/mL$로 처리 후 24시간까지 처리시간을 달리하여 처리하였다. 배양시간 동안 각 세포와 배양액을 회수하여 TNF-$\alpha$와 IL-1$\beta$의 발현을 mRNA 수준에서 조사하였다. 그 결과, THP-1의 경우 배양 2시간에서 TNF-$\alpha$나 IL-1$\beta$의 mRNA 발현이 대조구에 비해 증가되었으나 혈관내피세포인 HUVEC의 경우에는 24시간 배양하는 동안 유의적인 차이가 없었다. 그러나 두세포를 동시에 배양한 system에서 혈관내피세포인 HUVEC의 경우에는 배양 4시간에서 대조구보다 TNF-$\alpha$의 발현은 4.4배, IL-1$\beta$의 경우 5.5배 정도 증가되는 것을 확인할 수 있었다. TNF-$\alpha$와 IL-1$\beta$의 배지 내에서의 농도를 측정해 본 결과, THP-1만 배양한 경우 대조구의 배지 내 TNF-$\alpha$ 함량이 배양 6시간에 98.2 pg/mL로 대조구 53.8 pg/mL보다 증가하였으며 HUVEC의 경우 배양 8시간에 93.3 pg/mL로 증가하였다. 그러나 co-culture의 경우 배양 4시간부터 증가하여 배양 8시간에 199.2 pg/mL로 증가하였다. RAGE는 TNF-$\alpha$와 IL-1$\beta$의 발현 pattern과 다르게 단독 및 co-culture에서 배양 16시간에 대조구에 비해 각각 1.6배, 24시간에 1.9배 증가하였다. 따라서 본 연구 결과 최종당화산물에 의해 혈관내피세포의 기능상실의 연구에 있어 co-culture조건이 유용하며, 특히 mRNA 수준에서는 4시간에, protein 수준에서는 8시간에 효능을 측정하면 유효성 있는 연구 성과를 얻을 있을 것으로 예측할 수 있었다.
Glyceraldehyde를 이용하여 제조된 AGEs 화합물(glycer-AGEs)을 단구세포인 THP-1, 혈관내피세포인 HUVEC 및 이 두 세포가 동시에 배양된 system에서 100 ${\mu}g/mL$로 처리 후 24시간까지 처리시간을 달리하여 처리하였다. 배양시간 동안 각 세포와 배양액을 회수하여 TNF-$\alpha$와 IL-1$\beta$의 발현을 mRNA 수준에서 조사하였다. 그 결과, THP-1의 경우 배양 2시간에서 TNF-$\alpha$나 IL-1$\beta$의 mRNA 발현이 대조구에 비해 증가되었으나 혈관내피세포인 HUVEC의 경우에는 24시간 배양하는 동안 유의적인 차이가 없었다. 그러나 두세포를 동시에 배양한 system에서 혈관내피세포인 HUVEC의 경우에는 배양 4시간에서 대조구보다 TNF-$\alpha$의 발현은 4.4배, IL-1$\beta$의 경우 5.5배 정도 증가되는 것을 확인할 수 있었다. TNF-$\alpha$와 IL-1$\beta$의 배지 내에서의 농도를 측정해 본 결과, THP-1만 배양한 경우 대조구의 배지 내 TNF-$\alpha$ 함량이 배양 6시간에 98.2 pg/mL로 대조구 53.8 pg/mL보다 증가하였으며 HUVEC의 경우 배양 8시간에 93.3 pg/mL로 증가하였다. 그러나 co-culture의 경우 배양 4시간부터 증가하여 배양 8시간에 199.2 pg/mL로 증가하였다. RAGE는 TNF-$\alpha$와 IL-1$\beta$의 발현 pattern과 다르게 단독 및 co-culture에서 배양 16시간에 대조구에 비해 각각 1.6배, 24시간에 1.9배 증가하였다. 따라서 본 연구 결과 최종당화산물에 의해 혈관내피세포의 기능상실의 연구에 있어 co-culture조건이 유용하며, 특히 mRNA 수준에서는 4시간에, protein 수준에서는 8시간에 효능을 측정하면 유효성 있는 연구 성과를 얻을 있을 것으로 예측할 수 있었다.
Although monoculture methods have been remarkably useful due to their simplicity, they have serious limitation because of the different types of cells communication with each other in many physiological situations. We demonstrated levels of markers of endothelial dysfunction such as tumor necrosis f...
Although monoculture methods have been remarkably useful due to their simplicity, they have serious limitation because of the different types of cells communication with each other in many physiological situations. We demonstrated levels of markers of endothelial dysfunction such as tumor necrosis factor-$\alpha$ (TNF-$\alpha$) and interleukin-1$\beta$ (IL-1$\beta$) as well as stimulation of receptor of advanced glycation endproducts (AGEs) on monoand co-culture system such as only monocyte (THP-1) cultivation system, only endothelial cell (HUVEC) cultivation system, and co-cultivation system of THP-1 and HUVEC. The mRNA levels of TNF-$\alpha$ and IL-1$\beta$ on HUVEC increased by the co-culture with monocyte after 4 hr at 100 ${\mu}g/mL$ glyceraldehyde-AGE. The secreted protein contents into medium of TNF-$\alpha$ and IL-1$\beta$ increased after 8 hr approximately 2~2.5 times compared to mono-cultivation. In contrast, the mRNA level of receptor of AGE (RAGE) was relatively insensitive on the co-culture system. The mediators by which monocytes activate endothelial cell have not been fully elucidated. In this study we confirmed production of soluble cytokines such as TNF-$\alpha$ and IL-1$\beta$ by monocytes. Use of monocyte conditioned medium, which contains both cytokines, can activate endothelial cell.
Although monoculture methods have been remarkably useful due to their simplicity, they have serious limitation because of the different types of cells communication with each other in many physiological situations. We demonstrated levels of markers of endothelial dysfunction such as tumor necrosis factor-$\alpha$ (TNF-$\alpha$) and interleukin-1$\beta$ (IL-1$\beta$) as well as stimulation of receptor of advanced glycation endproducts (AGEs) on monoand co-culture system such as only monocyte (THP-1) cultivation system, only endothelial cell (HUVEC) cultivation system, and co-cultivation system of THP-1 and HUVEC. The mRNA levels of TNF-$\alpha$ and IL-1$\beta$ on HUVEC increased by the co-culture with monocyte after 4 hr at 100 ${\mu}g/mL$ glyceraldehyde-AGE. The secreted protein contents into medium of TNF-$\alpha$ and IL-1$\beta$ increased after 8 hr approximately 2~2.5 times compared to mono-cultivation. In contrast, the mRNA level of receptor of AGE (RAGE) was relatively insensitive on the co-culture system. The mediators by which monocytes activate endothelial cell have not been fully elucidated. In this study we confirmed production of soluble cytokines such as TNF-$\alpha$ and IL-1$\beta$ by monocytes. Use of monocyte conditioned medium, which contains both cytokines, can activate endothelial cell.
* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.
문제 정의
따라서 본 연구는 혈관내피세포의 기능상실에 매우 중요한 cytokine인 IL-1β과 TNF-α의 발현 정도와 AGEs 화합물인 조직으로 들어가는 receptor인 RAGE 발현 정도를 단구세포/혈관내피세포의 단독과 co-culture system을 비교하였다. 또한 AGEs에 의한 혈관성질환을 억제할 수 있는 효능물질 검색을 위한 최적의 time point를 전체적으로 조사하고자 하였다.
제안 방법
60 mm dish에서 glycer-AGE를 100 μg/mL로 처리한 다음, 24시간까지 처리하였으며 처리 후 배지를 회수하여 cytokine을 ELISA kit(Pierce endogen, Rockford, IL, USA)를 사용하여 측정하였다.
당화의 정도는 형광분석기(VICTORTM, Perkin Elmer, Rockville, MD, USA)를 이용하여 형광도(Ex 370 nm, Em 440 nm)를 측정하였다. Glycer-AGE의 제조는 0.1 M glyceraldehyde와 상기의 방법과 동일한 조건으로 진행하였으며 당화과정이 종료된 후 잔존하는 glyceraldehyde를 제거하기 위하여 투석(MWCO: 1000 KDa) 후 단백질 양을 측정한 다음 사용하였다. Glycer-AGE의 처리 농도는 많은 선행 연구자들이 처리하고 있는 100 μg/mL로 처리하였다(17,22,23).
Glyceraldehyde를 이용하여 제조된 AGEs 화합물(glycer-AGEs)을 THP-1, HUVEC 및 두 세포가 동시에 배양된 system에 100 μg/mL의 농도로 처리 후 24시간까지 처리시간을 달리하고 각 세포를 회수하여 TNF-α와 IL-1β 발현 pattern을 mRNA 수준에서 조사하였다.
Glyceraldehyde를 이용하여 제조된 AGEs 화합물(glycer-AGEs)을 단구세포인 THP-1, 혈관내피세포인 HUVEC 및 이 두 세포가 동시에 배양된 system에서 100 μg/mL로 처리 후 24시간까지 처리시간을 달리하여 처리하였다.
PCR은 94℃에서 3분(1 cycle), 94℃에서 1분, TNF-α는 63℃, IL-1β는 67℃, RAGE 62℃에서 1분 그리고 72℃에서 1분씩(25 cycles), 72℃에서 5분(1 cycle)간 실시하였다. PCR 산물은 1.2% agarose gel에 100 V에서 30분간 전기영동 후 자외선광으로 유전자 발현 정도를 알아보았다.
본 실험에 사용한 DL-glyceraldehyde, 2-deoxy-ribose, glycoaldehyde, glycoxal, diethylene triamine pentaacetic acid(DTPA), bovine serum albumin(BSA, low-endotoxin, fatty acid free)는 Sigma Chemical Co.(St. Louis, MO, USA)에서 구입하였으며, 혈관내피세포인 human umbilical vein endothelial cell(HUVEC), endothelial growth medium 2(EGM-2)는 Clonetics(San Diego, CA, USA), 단구세포인 THP-1(human acute monocytic leukemia cell line)은 American Type Culture Collection(Rockville, MD, USA)에서 구입하여 사용하였다. 이외의 세포 배양을 위한 배지 및 기타재료는 GIBCO-BRL(Gaithersburg, MD, USA)에서 구입하여 사용하였다.
THP-1은 Dulbecco's modified Eagle's medium(DMEM)에 10% fetal bovine serum(FBS), 100 U/mL penicillin 및 100 μg/mL strepto-mycin을 혼합한 배지를 사용하였다.
따라서 co-culture system의 연구에 앞서 AGEs 화합물을 제조하기 위한 당화물을 선정하였다. 4종의 당화물을 이용하여 AGEs 생성 속도를 측정한 결과(Fig.
실험에 사용한 primer sequence는 TNF-α의 forward는 GGCAGTCAGATCATCTTCTCGAA, reverse는 GAAGGCCTAAGGTCCACTTGT를 사용하였으며(26), IL-1β의 forward는 ATGGCAGAAGTACCTGAGCTC, reverse는 TTCCTTGAGGCCCAAGGCCAC를 사용하였으며(27), RAGE의 forward는 AGCCCTCTCCTCAAATCCACT, reverse는 ACTACTCTCGCCTGCCTCAG를 사용하였다(28).
Louis, MO, USA)에서 구입하였으며, 혈관내피세포인 human umbilical vein endothelial cell(HUVEC), endothelial growth medium 2(EGM-2)는 Clonetics(San Diego, CA, USA), 단구세포인 THP-1(human acute monocytic leukemia cell line)은 American Type Culture Collection(Rockville, MD, USA)에서 구입하여 사용하였다. 이외의 세포 배양을 위한 배지 및 기타재료는 GIBCO-BRL(Gaithersburg, MD, USA)에서 구입하여 사용하였다. HUVEC은 EGM-2 배지에서 배양하였으며 80∼90%의 confluence에서 실험하고, passage가 10번을 넘기지 않은 세포만 사용하였다.
데이터처리
Values are mean±SD and means with different letters (a-d) on bars are significantly different at p<0.05 by Duncan's multiple range tests.
Values are mean±SD and means with different letters (a-e) on bars are significantly different at p<0.05 by Duncan's multiple range tests.
Values are mean±SD and means with different letters (a-f) on bars are significantly different at p<0.05 by Duncan's multiple range tests.
Values are mean±SD and means with different letters (a-h) on bars are significantly different at p<0.05 by Duncan's multiple range tests.
군간의 유의성은 ANOVA test 후 구체적인 사후 검증은 p<0.05 수준에서 Duncan's multiple range test로 실시하였다.
실험 결과는 SPSS 10.0(SPSS Inc., Chicago, IL, USA)을 이용하여 통계 처리하였으며 data는 평균(mean)과 표준편차(standard deviation, SD)로 표시하였다. 군간의 유의성은 ANOVA test 후 구체적인 사후 검증은 p<0.
이론/모형
Total RNA 분리는 Trizol-base protocol을 이용하여 chloroform/isopropanol 법(25)으로 추출하여 cDNA를 합성하였다. 실험에 사용한 primer sequence는 TNF-α의 forward는 GGCAGTCAGATCATCTTCTCGAA, reverse는 GAAGGCCTAAGGTCCACTTGT를 사용하였으며(26), IL-1β의 forward는 ATGGCAGAAGTACCTGAGCTC, reverse는 TTCCTTGAGGCCCAAGGCCAC를 사용하였으며(27), RAGE의 forward는 AGCCCTCTCCTCAAATCCACT, reverse는 ACTACTCTCGCCTGCCTCAG를 사용하였다(28).
최종당화산물 즉, AGEs의 제조는 Takeuchi 등(21)이 보고한 방법에 따라 제조하였다. 그 과정을 간략히 기술하면, 10 mg/mL BSA, 5 mM DTPA과 각각의 당류(DL-glyceraldehyde, 2-deoxy-ribose, glycoaldehyde 혹은 glycoxal)를 농도를 달리하여 0.
성능/효과
따라서 co-culture system의 연구에 앞서 AGEs 화합물을 제조하기 위한 당화물을 선정하였다. 4종의 당화물을 이용하여 AGEs 생성 속도를 측정한 결과(Fig. 1), ribose와 glycoxal은 7일간의 반응에서도 AGE의 형성이 급격히 증가하지 않았으나 glycoaldehyde와 glyceraldehyde는 급격히 AGE 화합물이 형성되는 것을 확인하였으며 특히 glyceraldehyde가 가장 강력하게 AGE 화합물을 형성하였다.
Fig. 2의 결과를 보면, 단구세포인 THP-1의 경우 100 μg/mL의 glycer-AGE와 배양시킬 때 배양 2～3시간에서 배양전보다 유의적 차이를 보이면서 증가하였으며 대조구에 비해 2.2배 증가되는 것을 알 수 있었다.
RAGE는 TNF-α와 IL-1β의 발현과 다르게 혈관내피세포인 HUVEC은 단독 및 co-culture에서 배양 16시간에 대조구에 비해 각각 1.6배, 1.9배 증가하였다(Fig. 6).
TNF-α와 IL-1β의 m-RNA 수준에서는 배양 4시간에서 가장 높은 증가량을 보였고, 방출된 단백질의 수준에서는(배지 내에 함유된 단백질 양) 배양 8시간에 가장 많은 증가량을 보였다.
TNF-α와 IL-1β의 배지 내에서의 농도를 측정해 본 결과, THP-1만 배양한 경우 대조구의 배지 내 TNF-α 함량이 배양 6시간에 98.2 pg/mL로 대조구 53.8 pg/mL보다 증가하였으며 HUVEC의 경우 배양 8시간에 93.3 pg/mL로 증가하였다.
TNF-α와 IL-1β의 배지 내에서의 농도를 측정해본 결과 THP-1만 배양한 경우 대조구의 배지 내 TNF-α 함량이 배양 6시간에 98.2 pg/mL로 대조구 53.8 pg/mL보다 증가하였으며 HUVEC의 경우 배양 8시간에 93.3 pg/mL로 증가하였다.
그 결과, THP-1의 경우 배양 2시간에서 TNF-α나 IL-1β의 mRNA 발현이 대조구에 비해 증가되었으나 혈관내피세포인 HUVEC의 경우에는 24시간 배양하는 동안 유의적인 차이가 없었다.
특히 단구세포인 THP-1에 glycer-AGE를 처리한 경우 처리 2∼3시간 후에 TNF-α와 IL-1β가 증가하였다. 그러나 HUVEC의 경우 유의적인 증가가 확인되지 않았으나 co-culture할 때에는 대조군에 비해 5.5배까지 증가하는 것을 확인할 수 있었다. 이것은 AGEs에 의한 혈관내피세포의 cytokine의 발현은 단구세포와의 cell communication이 중요한 역할을 하는 것으로 추정할 수 있었다.
그러나 RAGE의 경우 TNF-α와 IL-1β의 결과와는 다르게 co-culture나 단독배양이나 큰 차이가 없음을 알 수 있었다.
그러나 두 세포를 동시에 배양한 system에서 혈관내피세포인 HUVEC의 경우에는 배양 1시간부터 유의적 차이를 보이면서 증가하였으며 배양 4시간에서 대조구보다 4.4배 정도까지 TNF-α의 발현이 증가된 후 다시 감소되는 것을 확인할 수 있었다.
그러나 두 세포를 동시에 배양한 system에서 혈관내피세포인 HUVEC의 경우에는 배양 1시간째부터 증가하여 배양 3～4시간에서 대조구보다 5.5배 정도까지 IL-1β의 발현이 증가되는 것을 확인할 수 있었다.
그러나 두 세포를 동시에 배양한 system에서 혈관내피세포인 HUVEC의 경우에는 배양 4시간에서 대조구보다 TNF-α의 발현은 4.4배, IL-1β의 경우 5.5배 정도 증가되는 것을 확인할 수 있었다.
그러나 RAGE의 경우 TNF-α와 IL-1β의 결과와는 다르게 co-culture나 단독배양이나 큰 차이가 없음을 알 수 있었다. 그러나 배양시간이 길어질수록 co-culture system에서 혈관내피세포에서 AGEs의 receptor의 발현이 증가하는 것으로 보아 증가된 cytokine의 영향은 있는 것으로 추정할 수 있었다.
9배 증가하였다. 따라서 본 연구 결과 최종당화산물에 의해 혈관내피세포의 기능상실의 연구에 있어 co-culture 조건이 유용하며, 특히 mRNA 수준에서는 4시간에, protein 수준에서는 8시간에 효능을 측정하면 유효성 있는 연구 성과를 얻을 있을 것으로 예측할 수 있었다.
배지 내 IL-1β 함량은 HUVEC의 경우 24시간 동안 큰 변화를 보이지 않았으나 co-culture의 경우 배양 6시간부터 증가하여 배양 8시간에 39.5 pg/mL로 증가하였다 배양 24시간에는 배양전과 같은 수준으로 감소하는 것을 알 수 있었다(Fig. 5).
본 연구 결과 AGEs에 의한 혈관내피세포의 기능상실의 연구에 있어서 혈관내피세포를 단독으로 연구하는 것보다 단구세포와 같이 co-culture할 때 TNF-α와 IL-1β 같은 cytokine의 발현이 더욱 증가하는 것을 확인할 수 있었다.
후속연구
따라서 실제의 경우를 반영하는 모델인 단구세포와 혈관내피세포의 co-culture system이 중요하다. 따라서 AGEs 화합물에 의한 혈관내피세포의 기능상실의 연구를 위해서는 co-culture system이 확립되어야 하며, 이 system을 이용하여 AGEs에 의한 기전연구 및 이를 억제할 수 있는 식품소재에 대한 연구가 진행되어야 할 것이다.
본 연구결과 최종당화산물에 의해 혈관내피세포의 기능상실의 연구에 있어 식품소재나 천연소재로부터 효능물질의 유효성 검색 시 본 연구결과에서 얻은 co-culture 조건이 유용하게 사용될 것이며 특히 mRNA 수준에서는 처리 후 4시간에, protein 수준에서는 8시간에 효능을 측정하면 유효성 있는 연구 성과를 얻을 있을 것으로 기대된다.
질의응답
핵심어
질문
논문에서 추출한 답변
AGE에 의한 동맥경화는 어떤 기전에 의해 일어나는가?
AGE에 의해 동맥경화는 다음과 같은 기전에 의해 일어난다고 알려져 있다. 먼저 혈액 내에 존재하는 LDL의 인지질 성분에서 glycation 반응에 의해 LDL의 산화변성이 일어나며(7), 이렇게 변성된 LDL은 혈관내피세포에 존재하는 receptor of AGEs(RAGE)를 통해 내막(intima)으로 흡수되어 거품세포(foam cell)의 형성을 촉진하며(8,9), 콜레스테롤에스터(cholesterol ester)의 축적(10) 등 혈관조직의 정상적인 기능을 저하시켜 최종적으로는 동맥경화와 같은 질환을 일으키는 것으로 보고되고 있다(11-13).
글라이케이션 반응은 어디에서 일어나는가?
글라이케이션 반응, 혹은 non-enzymatic glycation 반응이란 환원당의 carbonyl기가 단백질의 유리아미노기인 lysine이나 arginine과 반응하여 초기 Shiff base를 형성하고, 계속적으로 축합, 재전위, 산화, 분열, 고리화 등의 일련의 복잡한 반응을 통하여 갈색의 비가역적 최종당화산물(advanced end-products, AGEs)을 만드는 반응이다(1). 이 반응은 모든 단백질의 ε-amino group이나 N-terminal group에서 일어나며 또한 아미노산을 함유하고 있는 콜라젠, DNA나 low-density lipoprotein(LDL)과 같은 혈청 단백질과 쉽게 공유결합 하여 체내에서도 AGEs 화합물을 만든다고 알려져 있다(2). 생체내의 glycation 반응은 몇 주 정도에 걸쳐 일어날 정도로 천천히 일어나지만 일단 반응이 시작되면 비가역적 반응으로 AGEs 화합물이 체내에 축적되게 되면서 여러 가지 질병을 일으킨다(3).
글라이케이션 반응이란 무엇인가?
글라이케이션 반응, 혹은 non-enzymatic glycation 반응이란 환원당의 carbonyl기가 단백질의 유리아미노기인 lysine이나 arginine과 반응하여 초기 Shiff base를 형성하고, 계속적으로 축합, 재전위, 산화, 분열, 고리화 등의 일련의 복잡한 반응을 통하여 갈색의 비가역적 최종당화산물(advanced end-products, AGEs)을 만드는 반응이다(1). 이 반응은 모든 단백질의 ε-amino group이나 N-terminal group에서 일어나며 또한 아미노산을 함유하고 있는 콜라젠, DNA나 low-density lipoprotein(LDL)과 같은 혈청 단백질과 쉽게 공유결합 하여 체내에서도 AGEs 화합물을 만든다고 알려져 있다(2).
참고문헌 (33)
Monnier VM, Elmets CA, Frank KE, Vishwanath V, YamashitaT. 1986. Age-related normalization of the browning rate of collagen in diabetic subjects without retinopathy.J Clin Invest 78: 832-835.
Vishwanath V, Frank KE, Elmets CA, Dauchot PJ, MonnierVM. 1986. Glycation of skin collagen in type I diabetes mellitus. Correlation with long-term complications. Diabetes35: 916-921.
Mullarkey CJ, Edelstein D, Brownlee M. 1990. Free radical generation by early glycation products: a mechanism for accelerated atherogenesis in diabetes. Biochem Biophys Res Commun 173: 932-939.
Hammes HP, Alt A, Niwa T, Clausen JT, Bretzel RG,Brownlee M, Schleicher ED. 1999. Differential accumulation of advanced glycation end products in the course of diabetic retinopathy. Diabetologia 42: 728-736.
Hsieh CL, Lin YC, Ko WS, Peng CH, Huang CN, Peng RY.2005. Inhibitory effect of some selected nutraceutic herbs on LDL glycation induced by glucose and glyoxal. J Ethnopharmacol 102: 357-363.
Ma H, Li SY, Xu P, Babcock SA, Dolence EK, BrownleeM, Li J, Ren J. 2009. Advanced glycation endproduct (AGE) accumulation and AGE receptor (RAGE) upregulation contribute to the onset of diabetic cardiomyopathy. J Cell Mol Med 13: 1751-1764.
Magalhaes PM, Appell HJ, Duarte JA. 2008. Involvement of advanced glycation end products in the pathogenesis of diabetic complications: the protective role of regular physical activity. Eur Rev Aging Phys A 5: 17-29.
Goh SY, Cooper ME. 2008. Clinical review: The role of advanced glycation end products in progression and complications of diabetes. J Clin Endocrinol Metab 93: 1143-1152.
Linden E, Cai W, He JC, Xue C, Li Z, Winston J, VlassaraH, Uribarri J. 2008. Endothelial dysfunction in patients with chronic kidney disease results from advanced glycation end products (AGE)-mediated inhibition of endothelial nitric oxide synthase through RAGE activation. Clin J Am Soc Nephrol 3: 691-698.
Lo CY, Li S, Tan D, Pan MH, Sang S, Ho CT. 2006.Trapping reactions of reactive carbonyl species with tea polyphenols in simulated physiological conditions. Mol Nutr Food Res 50: 1118-1128.
Takada M, Ku Y, Toyama H, Suzuki Y, Kuroda Y. 2002.Suppressive effects of tea polyphenol and conformational changes with receptor for advanced glycation end products (RAGE) expression in human hepatoma cells. Hepatogastroenterology49: 928-931.
Ahmad MS, Ahmed N. 2006. Antiglycation properties of aged garlic extract: possible role in prevention of diabetic complications. J Nutr 136: 796S-799S.
Lee HS, Koo YC, Suh HJ, Kim KY, Lee KW. 2010.Preventive effects of chebulic acid isolated from Terminalia chebula on advanced glycation endproduct-induced endothelial cell dysfunction. J Ethnopharmacol 131: 567-574.
Devaraj S, Dasu MR, Rockwood J, Winter W, Griffen SC,Jialal I. 2008. Increased toll-like receptor (TLR) 2 and TLR4 expression in monocytes from patients with type 1 diabetes: further evidence of a proinflammatory state. J Clin Endocrinol Metab 93: 578-583.
Basta G, Schmidt AM, De Caterina R. 2004. Advanced glycation end products and vascular inflammation: implications for accelerated atherosclerosis in diabetes. Cardiovasc Res63: 582-592.
Takeuchi M, Makita Z, Bucala R, Suzuki T, Koike T,Kameda Y. 2000. Immunological evidence that non-carbox-ymethyllysineadvanced glycation end-products are produced from short chain sugars and dicarbonyl compounds in vivo. Mol Med 6: 114-125.
Okamoto T, Yamagishi S, Inagaki Y, Amano S, TakeuchiM, Kikuchi S, Ohno S, Yoshimura A. 2002. Incadronate disodium inhibits advanced glycation end products-induced angiogenesis in vitro. Biochem Biophys Res Commun 297:419-424.
Niiya Y, Abumiya T, Shichinohe H, Kuroda S, Kikuchi S,Ieko M, Yamagishi S, Takeuchi M, Sato T, Iwasaki Y. 2006.Susceptibility of brain microvascular endothelial cells to advanced glycation end products-induced tissue factor upregulation is associated with intracellular reactive oxygen species. Brain Res 1108: 179-187.
Tsouknos A, Nash GB, Rainger GE. 2003. Monocytes initiate a cycle of leukocyte recruitment when cocultured with endothelial cells. Atherosclerosis 170: 49-58.
Shibata M, Hariya T, Hatao M, Ashikaga T, Ichikawa P. 1999. Quantitative polymerase chain reaction using an external control mRNA for determination of gene expression in a heterogeneous cell population. Toxicol Sci 49: 290-296.
Tanji K, Mori F, Imaizumi T, Yoshida H, Matsumiya T,Tamo W, Yoshimoto M, Odagiri H, Sasaki M, TakahashiH, Satoh K, Wakabayashi K. 2002. Upregulation of $\alpha$ -synuclein by lipopolysaccharide and interleukin-1 in human macrophages. Pathology International 52: 572-577.
Heraud JM, Lavergne A, Kazanji M. 2002. Molecular cloning, characterization, and quantification of squirrel monkey (Saimiri sciureus) Th1 and Th2 cytokines. Immunogenetics 54: 20-29.
Lee SJ, Lee WK. 2007. Protective effect of (-)-epigallocatechin gallate against advanced glycation endproducts-induced injury in neuronal cells. Biol Pharm Bull 30: 1369-1373.
Sato T, Shimogaito N, Wu X, Kikuchi S, Yamagishi S,Takeuchi M. 2006. Toxic advanced glycation end products (TAGE) theory in Alzheimer's disease. Am J Alzheimers Dis Other Demen 21: 197-208.
Munch G, Schinzel R, Loske C, Wong A, Durany N, Li JJ,Vlassara H, Smith MA, Perry G, Riederer P. 1998.Alzheimer's disease-synergistic effects of glucose deficit,oxidative stress and advanced glycation endproducts. J Neural Transm 105 : 439-461.
Matsuse T, Ohga E, Teramoto S, Fukayama M, Nagai R,Horiuchi S, Ouchi Y. 1988. Immunohistochemical localisation of advanced glycation end products in pulmonary fibrosis. J Clin Pathol 51: 515-519.
Dunon D, Piali L, Imhof B. 1996. To stick or not to stick-the new leukocyte homing paradigm. Curr Opin Cell Biol 8:714-723.
※ AI-Helper는 부적절한 답변을 할 수 있습니다.