[논문]GM-CSF가 돼지 처녀 생식 배아 발달에 미치는 영향

이재달

doi:10.5762/kais.2015.16.1.365

GM-CSF가 돼지 처녀 생식 배아 발달에 미치는 영향
Effect of GM-CSF on Porcine Parthenotes Development 원문보기

한국산학기술학회논문지 = Journal of the Korea Academia-Industrial cooperation Society, v.16 no.1, 2015년, pp.365 - 370

초록
AI-Helper

GM-CSF는 중요한 조혈모세포 성장인자로서 면역요법에서 중요한 기능을 한다. 본 연구의 목적은 GM-CSF가 돼지 처녀생식배아의 발달과 세포 수 및 착상관련 유전자의 발현에 관한 영향을 평가하는 것이다. 본 연구에서 돼지 처녀 활성화 배아는 GM-CSF가 5, 10, 20 ng/ml 존재 하에서 7일 동안 배양하여 배 반포의 형성율과 전 세포 수 그리고 유전자 발현을 평가하였다. 그 결과 단백질이 없는 배양액에 20 ng/ml의 GM-CSF를 첨가 하였을 때 배 반포의 형성 율이 유의적으로 증가하였으며 배반포의 세포 수 또한 GM-CSF 를 첨가한 배양액에서 증가 하였다. GM-CSF는 처녀생식 배 반포에서 interleukin-6의 mRNA 발현을 증가 시켰으나, LIF 수용체 mRNA 발현에는 영향을 주지 않는다는 것을 real time RT-PCR로 밝혀내었다. 이 결과로 GM-CSF 성분이 확인된 배양액에서 돼지 배아의 체외 발달 과 생존력을 강화 시켰음을 시사하고 있다.

Abstract ▼ AI-Helper

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is an important hematopoietic growth factor and immune modulator. The aim of this study was to evaluate the effects of GM-CSF on the development and cell number of porcine parthenotes, as well as on their expression of implantation-related genes. In the present study, porcine parthenogenatic activated embryos were cultured in a protein-free culture medium in the absence or presence of 5, 10 and 20 ng/ml GM-CSF for 7 days. The percentage of blastocyst formation, total cell number and gene expressions were evaluated. The results showed that the addition of 20 ng/ml GM-CSF to protein-free culture medium significantly increased the blastocoel formation ($26.14{\pm}2.03%$ vs. $3.55{\pm}0.51%$, p < 0.05). In addition, the cell number also increased when they were cultured in the presence of 20 ng/ml GM-CSF ($43.51{\pm}3.6%$ vs. $30.68{\pm}5.51%$, p < 0.05). A real time reverse transcripts polymerase chain reaction (RT-PCR) showed that GM-CSF enhances mRNA expression of the interleukin-6, but does not influence the leukemia inhibitory factor (LIF) receptor mRNA expression in blastocyst stage parthenotes. These results suggest that GM-CSF may enhance the viability of porcine embryos developing in vitro in a defined culture medium.

주제어

AI 본문요약
AI-Helper

* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.

가설 설정

In this study, we examined the effect of GM-CSF on in vitro development of porcine diploid parthenotes and cell numbers in the absence of BSA. We also determined the effect of GM-CSF on the expression of implantation-related genes such as LIF receptor (LIF-r) and IL-6 in porcine parthenotes by real time reverse transcription polymerase chain reaction.

제안 방법

Experiment 1 examined the effect of GM-CSF (Sigma, G-0282) on porcine parthenotes when added to their culture medium in the absence of BSA. Parthenogenetically-activated oocytes were washed three times in NCSU 37 medium without BSA and then randomly cultured in the same medium containing 0, 5, 10, or 20 ng/ml GM-CSF.
Experiment 2 was conducted to determine the effect of GM-CSF on the total cell numbers in blastocyst, embryos were harvested at day 7 and cell numbers were counted.
To investigate whether GM-CSF modulates mRNA expression of implantation-related genes in porcine embryos developing in vitro, mRNA prepared from 10 blastocysts was reverse transcribed and analyzed by PCR with primers specific for IL-6 and LIF-r cDNAs.

데이터처리

05 being considered significant. A paired student t-test was used to compare relative gene expression.

이론/모형

Real time RT-PCR was performed using the three primer sets (GAPDH, AF017079, forward primer: GGGCATGAACCATGAGAAGT, reverse primer: AAGCAGGGATGATGTTCTGG; IL-6, M80258, forward primer: ACAAAGCCACCACCCCTAAC, reverse primer: ACATTATCCGAATGGCCCTC; LIF-r, U91518, forward primer: ATACAGACGGAGGAATGGGC, reverse primer: CCACTCCAACAATGACTGCC) by DNA Engine OPTICOJ 2 (MJ research, USA). The relative quantification of gene expression was analyzed using the 2-ddCt method. In all experiments, GAPDH mRNA was employed as an internal standard for the analysis of relative transcript levels

성능/효과

To test if GM-CSF affect cell numbers, total nuclei numbers were analysed by Hoechst staining in porcine blastocyst-stage parthenote , as shown in Figure2, cell number in 20 ng/ml GM-CSF treatment group(43.51 ± 3.6)cell number was significantly (p < 0.05) increased than control(30.68±5.51) but 5 and 10 ng/ml GM-CSF did not affect it.

참고문헌 (17)

van Montfort, T., et al., A chimeric HIV-1 envelope glycoprotein trimer with an embedded granulocytemacrophage colony-stimulating factor (GM-CSF) domain induces enhanced antibody and T cell responses. J Biol Chem, 286(25): p. 2250-61. 2011 DOI: http://dx.doi.org/10.1074/jbc.M111.229625
Shi, Y., et al., Granulocyte-macrophage colony-stimulating factor (GM-CSF) and T-cell responses: what we do and don't know. Cell Res, 16(2): p. 126-33. 2006. DOI: http://dx.doi.org/10.1038/sj.cr.7310017

상세보기
de Moraes, A.A. and P.J. Hansen, Granulocyte-macrophage colony-stimulating factor promotes development of in vitro produced bovine embryos. Biol Reprod, 57(5): p. 1060-5. 1997 DOI: http://dx.doi.org/10.1095/biolreprod57.5.1060

상세보기
Imakawa, K., et al., A novel role for GM-CSF: enhancement of pregnancy specific interferon production, ovine trophoblast protein-1. Endocrinology, 132(4): p. 1869-71. 1993 DOI: http://dx.doi.org/10.1095/biolreprod57.5.1060

상세보기
Robertson, S.A., GM-CSF regulation of embryo development and pregnancy. Cytokine Growth Factor Rev, 18 (3-4): p. 287-98. 2007 DOI: http://dx.doi.org/10.1016/j.cytogfr.2007.04.008

상세보기
Ziebe, S., et al., A randomized clinical trial to evaluate the effect of granulocyte-macrophage colony-stimulating factor (GM-CSF) in embryo culture medium for in vitro fertilization. Fertil Steril, 99 (6): p. 1600-9, 2013 DOI: http://dx.doi.org/10.1016/j.fertnstert.2012.12.043

상세보기
Hardy,k.,A.H. Handyside, and R.M. Winston, The human blastocyst; cell number, deat and allocation during late preimplantation development in vitro. dev, 107(3): p597-604.1989
Wang, W.H. and B.N. Day, Development of porcine embryos produced by IVM/IVF in a medium with or without protein supplementation: effects of extracellular glutathione. Zygote, 10(2): p. 109-15, 2002 DOI: http://dx.doi.org/10.1017/S0967199402002150

상세보기
Stewart, C.L. and E.B. Cullinan, Preimplantation development of the mammalian embryo and its regulation by growth factors. Dev Genet, 21(1): p. 91-101, 1997 DOI: http://dx.doi.org/10.1002/(SICI)1520-6408(1997)21:1 3.0.CO;2-D

상세보기
Kim DH, et al., Effect of GM-CSF on the embryonic development and the expression of implantation related genes of mouse embryos. . Kor J Fertil Steril, . 2002 (29): p. 83-90, 2002
Steel, R.G.D. and J.H. Torrie, Principles and Procedures of Statistics, NY: Mcgraw Hill Book co .2000
Ruef, C .and D .L. Coleman, colony - stimulating factor: pleiotropic cytokine with potential clinical usefulness. Rev Infect Dis, 12(1): p. 41-62,2006 DOI: http://dx.doi.org/10.1093/clinids/12.1.41
Elaimi, A., et al., The effect of GM-CSF on development and aneuploidy in murine blastocysts. Hum Reprod, 27(6): p. 1590-5,2012 DOI: http://dx.doi.org/10.1093/humrep/des108

상세보기
Watson, A.J., The cell biology of blastocyst development. Mol Reprod Dev,. 33 (4): p. 492-504,2006 DOI: http://dx.doi.org/10.1002/mrd.1080330417
Hernandez-Ledezma, J.J., et al., Expression of bovine trophoblast interferon in conceptuses derived by in vitro techniques. Biol Reprod, 47(3): p. 374-80,1992 DOI: http://dx.doi.org/10.1095/biolreprod47.3.374

상세보기
Desai, N., et al., Evaluation of the effect of interleukin-6 and human extracellullar matrix on embryonic development. Hum Reprod, 14(6): p. 1588-92,1999 DOI: http://dx.doi.org/10.1093/humrep/14.6.1588

상세보기
Conquet, F. and P. Brulet, Developmental expression of myeloid leukemia inhibitory factor gene in preimplantation blastocysts and in extraembryonic tissue of mouse embryos. Mol Cell Biol, 10(7): p. 3801-5,2007

내보내기 구분	파일저장 인쇄 메일전송
구성항목	기본정보 상세정보 관리번호, 논문명, 저널/프로시딩명, 저자 , 발행년, 권, 호, 시작페이지, 끝페이지, 발행기관 관리번호, 논문명, 대등논문명, 저자 , 저널/프로시딩명, 발행기관, 발행년, 발행언어, 권, 호, 시작페이지, 끝페이지, ISBN, ISSN, 주제분야, 키워드, 초록(한글), 초록(영문), 저자(소속기관)
저장형식	Text(ASCII format) Excel format RefWorks Direct Export RIS format (for Reference Manager, ProCite, EndNote), Scholar's Aids, Mendeley
메일정보	받는사람 (필수) @ 보내는사람 (선택) @ 제목 내용 KISTI 검색결과 이메일 서비스
안내	총 건의 자료가 검색되었습니다. 다운받으실 자료의 인덱스를 입력하세요. (1-10,000) 검색결과의 순서대로 최대 10,000건 까지 다운로드가 가능합니다. 데이타가 많을 경우 속도가 느려질 수 있습니다.(최대 2~3분 소요) 다운로드 파일은 UTF-8 형태로 저장됩니다. 파일의 내용이 제대로 보이지 않을실 때는 웹브라우저 상단의 보기 -> 인코딩 -> 자동선택 여부를 확인하십시오. ~ Text(ASCII format) Excel format

연합인증