Wang, Wenshuo
(Department of Cardiac Surgery, Zhongshan Hospital of Fudan University and Shanghai Institute of Cardiovascular Diseases)
,
Yang, Ye
(Department of Cardiac Surgery, Zhongshan Hospital of Fudan University and Shanghai Institute of Cardiovascular Diseases)
,
Wang, Yiqing
(Department of Cardiothoracic Surgery, Huashan Hospital of Fudan University)
,
Pang, Liewen
(Department of Cardiothoracic Surgery, Huashan Hospital of Fudan University)
,
Huang, Jiechun
(Department of Cardiothoracic Surgery, Huashan Hospital of Fudan University)
,
Tao, Hongyue
(Department of Radiology, Huashan Hospital of Fudan University)
,
Sun, Xiaotian
(Department of Cardiothoracic Surgery, Huashan Hospital of Fudan University)
,
Liu, Chen
(Department of Cardiac Surgery, Zhongshan Hospital of Fudan University and Shanghai Institute of Cardiovascular Diseases)
Communication between endothelial cells (ECs) and smooth muscle cells (SMCs) via miR-143/145 clusters is vital to vascular stability. Previous research demonstrates that miR-143/145 released from ECs can regulate SMC proliferation and migration. In addition, a recent study has found that SMCs also h...
Communication between endothelial cells (ECs) and smooth muscle cells (SMCs) via miR-143/145 clusters is vital to vascular stability. Previous research demonstrates that miR-143/145 released from ECs can regulate SMC proliferation and migration. In addition, a recent study has found that SMCs also have the capability of manipulating EC function via miR-143/145. In the present study, we artificially increased the expression of miR-143/145 in ECs, to mimic a similar change caused by miR-143/145 released by SMCs, and applied untargeted metabolomics analysis, aimed at investigating the consequential effect of miR-143/145 overexpression. Our results showed that miR-143/145 overexpression alters the levels of metabolites involved in energy production, DNA methylation, and oxidative stress. These changed metabolites indicate that metabolic pathways, such as the SAM cycle and TCA cycle, exhibit significant differences from the norm with miR-143/145 overexpression.
Communication between endothelial cells (ECs) and smooth muscle cells (SMCs) via miR-143/145 clusters is vital to vascular stability. Previous research demonstrates that miR-143/145 released from ECs can regulate SMC proliferation and migration. In addition, a recent study has found that SMCs also have the capability of manipulating EC function via miR-143/145. In the present study, we artificially increased the expression of miR-143/145 in ECs, to mimic a similar change caused by miR-143/145 released by SMCs, and applied untargeted metabolomics analysis, aimed at investigating the consequential effect of miR-143/145 overexpression. Our results showed that miR-143/145 overexpression alters the levels of metabolites involved in energy production, DNA methylation, and oxidative stress. These changed metabolites indicate that metabolic pathways, such as the SAM cycle and TCA cycle, exhibit significant differences from the norm with miR-143/145 overexpression.
To quantitate miR-143 and miR-145 concentrations, an NCode miRNA First Strand cDNA synthesis kit (Invitrogen) was applied to polyadenylate and the total RNA was reversely transcribed. Quantitative real-time PCR (qPCR) was performed with SYBR Green PCR master mix (Applied Biosystems) on an ABI 7300 system. The primers were CCCTCTAACACCCCTTCTCC (miR-143 forward), TCTCAGACTCCCAACTGACCA (miR-143 reverse), CCAGAGGGTTTCCGGTACTT (miR-145 forward), and CGGATG TGGCTTATTGCTCT (miR-145 reverse).
성능/효과
Moreover, epigenetic changes in EC modulate angiogenesis [21]. Our results showed that the level of SAM changed owing to miR-143/145 overexpression. It has been proven that SAM can suppress angiogenesis through participation in the maintenance of genome stability, especially the modification of the status of angiogenesis-related genes [20].
참고문헌 (26)
Abramsson A, Lindblom P, Betsholtz C. 2003. Endothelial and nonendothelial sources of PDGF-B regulate pericyte recruitment and influence vascular pattern formation in tumors. J. Clin. Invest. 112: 1142-1151.
Benjamin LE, Hemo I, Keshet E. 1998. A plasticity window for blood vessel remodelling is defined by pericyte coverage of the preformed endothelial network and is regulated by PDGF-B and VEGF. Development 125: 1591-1598.
Benton HP, Ivanisevic J, Mahieu NG, Kurczy ME, Johnson CH, Franco L, et al. 2014. Autonomous metabolomics for rapid metabolite identification in global profiling. Anal. Chem. 87: 884-891.
Climent M, Quintavalle M, Miragoli M, Chen J, Condorelli G, Elia L. 2015. TGFβ triggers miR-143/145 transfer from smooth muscle cells to endothelial cells, thereby modulating vessel stabilization. Circ. Res. 116: 1753-1764.
Condorelli G, Latronico MV, Cavarretta E. 2014. MicroRNAs in cardiovascular diseases: current knowledge and the road ahead. J. Am. Coll. Cardiol. 63: 2177-2187.
Cordes KR, Sheehy NT, White MP, Berry EC, Morton SU, Muth AN, et al. 2009. miR-145 and miR-143 regulate smooth muscle cell fate and plasticity. Nature 460: 705-710.
Du Z, Zhou Y, Lu X, Li L, Lu C, Li L, et al. 2016. Octreotide prevents liver failure through upregulating 5’-methylthioadenosine in extended hepatectomized rats. Liver Int. 36: 212-222.
Ebos JM, Lee CR, Cruz-Munoz W, Bjarnason GA, Christensen JG, Kerbel RS. 2009. Accelerated metastasis after short-term treatment with a potent inhibitor of tumor angiogenesis. Cancer Cell 15: 232-239.
Elia L, Quintavalle M, Zhang J, Contu R, Cossu L, Latronico MV, et al. 2009. The knockout of miR-143 and -145 alters smooth muscle cell maintenance and vascular homeostasis in mice: correlates with human disease. Cell Death Differ. 16: 1590-1598.
Goel S, Duda DG, Xu L, Munn LL, Boucher Y, Fukumura D, Jain RK. 2011. Normalization of the vasculature for treatment of cancer and other diseases. Physiol. Rev. 91: 1071-1121.
Sahin M, Sahin E, Gumuslu S, Erdogan A, Gultekin M. 2010. DNA methylation or histone modification status in metastasis and angiogenesis-related genes: a new hypothesis on usage of DNMT inhibitors and S-adenosylmethionine for genome stability. Cancer Metastasis Rev. 29: 655-676.
Sonnen JA, Gray S, Larson EB, Montine TJ. 2008. Oxidative damage to human cortex in aging an antioxidant use. FASEB J. 22:167-162.
Sreekumar A, Poisson LM, Rajendiran TM. 2009. Metabolome profiles delineate potential role for sarcosine in prostate cancer progression. Nature 457: 910-914.
Turpeinen A, Basu S, Mutanen M. 1998. A high linoleic acid diet increases oxidative stress in vivo and affects nitric oxide metabolism in humans. Prostaglandins Leukot. Essent. Fatty Acids 59: 229-233.
Velazquez OC. 2007. Angiogenesis and vasculogenesis: inducing the growth of new blood vessels and wound healing by stimulation of bone marrow-derived progenitor cell mobilization and homing. J. Vasc. Surg. 45: 39-47.
※ AI-Helper는 부적절한 답변을 할 수 있습니다.