선택한 단어 수는 입니다.
최소 단어 이상 선택하여야 합니다.
최소 단어 이상 선택하여야 합니다.
선택한 단어 수는 30입니다.
최대 10 단어까지만 선택 가능합니다.
최대 10 단어까지만 선택 가능합니다.
제안 방법
- Similarly, a crude extract from the basidiomycete Quambalaria cyanescens was also found to have antifungal activities [13]. In that study, chromatography was used to isolate 3 napthoquinone-derived compounds. In the aforementioned study by Gao et al.
- In the first experiment, the mycelial growths of the two wood decay fungi were screened to determine fungistatic activities of the crude preparation at five concentrations (100, 10, 1, 0.1 and 0.01%, v/v) of A. ingoldii R-8 secondary metabolites obtained by serial dilution of the spent PDB medium with fresh PDB medium followed by dispensing into the wells of a sterile standard size 24-well culture plate (Falcon Becton Dickson, NJ, USA). Undiluted PDB medium dispensed into separate wells served as the control.
- In the second experiment, the mycelial diameter growth was measured to determine the antifungal index of A. ingoldii secondary metabolites in a narrower range of concentrations. To do this, the potato dextrose agar (PDA) medium was amended with six different concentrations (10, 5, 2.
- Gibbstown, NJ, USA). PCR amplification was conducted using the forward primer ITS1F (50 CTTGGTCATTTAGAGGAAGTAA0 3) [10] and reverse primer ITS4R (50 -TCCTCCGCTTA TTGATATGC0 3) [11]. The sequenced and amplified PCR product from the ITS region (GenBank Accession No.
- 22 mm syringe filter (Millipore, Dublin, Ireland) to eliminate any remaining suspended spores. The effect of the A. ingoldii R-8 secondary metabolites on the mycelial growth, for both G. trabeum and T. versicolor, was evaluated at different concentrations of the crude preparation in two experimental setups.
- To do this, the potato dextrose agar (PDA) medium was amended with six different concentrations (10, 5, 2.5, 1, 0.5, and 0.1% v/v) of A. ingoldii crude preparation in 100 × 15 mm sterile polystyrene petri dishes (Falcon Becton Dickson, NJ, USA).
대상 데이터
- The brown-rot (Gloeophyllum trabeum Mad-617, ATCC-11539) and white-rot (Trametes versicolor Mad697, ATCC-42462) strains used in this study were provided by the USDA Forest Products Laboratory (Madison, WI, USA). Cultures were grown and maintained on a medium containing 2% malt extract, 1.
- PCR amplification was conducted using the forward primer ITS1F (50 CTTGGTCATTTAGAGGAAGTAA0 3) [10] and reverse primer ITS4R (50 -TCCTCCGCTTA TTGATATGC0 3) [11]. The sequenced and amplified PCR product from the ITS region (GenBank Accession No. KT998902), with 98% similarity with the CBS 10050 strain (GenBank Accession No. NR_073342.1), was submitted to the National Center for Biotechnology Information (NCBI) GenBank database.
데이터처리
- Significant differences (p < .05) were determined by using the Student’s t-test.
- The mean comparison of antifungal indexes were conducted in SAS-JMP v13 (SAS Inc., NC, USA). Significant differences (p < .
※ AI-Helper는 부적절한 답변을 할 수 있습니다.