[논문]애기장대 형질전환 식물체의 세대경과에 따른 GUS유전자의 비활성화에 관한 연구

Park, Soon-Ki

doi:10.5352/jls.2002.12.1.067

애기장대 형질전환 식물체의 세대경과에 따른 GUS유전자의 비활성화에 관한 연구
The increased GUS gene inactivation over generation in Arabidopsis transgenic lines 원문보기

생명과학회지 = Journal of life science, v.12 no.1 = no.50, 2002년, pp.67 - 76

Park, Soon-Ki (Department of Agronomy, Kyungpook National University)

초록
AI-Helper

Agrobacterium(LBA4404/pBI1121)을 이용하여 형질전환된 애기장대 (Arabidopsis thaliana)를 대상으로 T2, T3, F3세대에서의 도입된 외래 유전자의 비활성화 현상을 조사하였다. Kanamaycin저항성 개체들의 GUS유전자 발현을 분석한 결과, T2세대에서 조사된 12계통 중 5계통에서 GUS 비활성 개체가 관찰되었다 (GUS유전자 비활성율 2.3%). Multi copy T-DNA 계통을 조사한 결과, GUS 비활성 정도가 더욱 심해짐이 관찰되었다 (5.8%). T3 세대에서 single copy T-DNA 계통들은 1.3%의 GUS 비활성율을 보인 반면, multi-copy T-DNA 계통에서의 비활성율은 12.6%로 급격히 증가하였다. 유사한 현상이 형질전환 식물체와 정상개체를 교배하여 생산된 F2 계통에서도 관찰되었다 (비활성율 9.9%). 본 실험으로 식물체에 도입된 외래 유전자가 후대에서의 전이과정동안 점진적으로 비활성화되고, 이 현상은 multi copy T-DNA 계통에서 훨씬 심각함이 밝혀졌다.

Abstract ▼ AI-Helper

The effect of transgene inactivation in T2, T3 and F2 generations was analyzed in progeny seedlings which had been generated by Agrobacterium (LBA4404/pBI121)-mediated transformation in Arabidopsis thaliana. In a system which investigated in the expression of $\beta$-glucuronidase(GUS)gene in kanamycin-resistant (ke $n^{R}$)seedlings, GUS inactivated seedlings were observed in 5 of 12 tested lines of T2 generation and the frequency of GUS inactivation was approximately 2.3%. Lines with multi-copies of T-DNA exhibited severe GUS gene inactivation with the frequency of 5.8% in T2 generation. In T3 generation lines exhibited GUS gene inactivation with the frequency of 1.3%. In contrast, inactivation increased dramatically up to 12.6% in multi-copy T-DNA line. A similar phenomenon was also found in F2 progeny from a transgenic line which had been crossed with wild-type Arabidopsis plant, WS-O (GUS gene inactivation frequency 9.9%). These results indicate that the foreign gene introduced into the plant was inactivated progressively in its transmission during subsequent generations and the transgenic line with multi-copies of T-DNA tended to show more increased inactivation.

주제어

AI 본문요약
AI-Helper

* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.

문제 정의

In this paper, the transgene inactivation in Arabidopsis transgenic lines was investigated in T2 and T3 generation, focusing on determining the relationship between the extent of transgene inactivation and generation progress. In order to do that, the differential inactivation system of GUS reporter gene and neomycin phosphotransferase-II (nptll) seletion marker was used as the approach of analyzing frequencies of transgene inactivation in T2 and T3 generation.

가설 설정

Although it has not been possible to determine the precise frequency of nptll gene suppression, this must be less low (1%>) when com pared to that of GUS inactivation. From the above it is proposed that nptll gene including nos promoters may be methylated at low frequency. The cause of these results that nptll gene is less sensitive to methylation, appears to be the effect of election pressure when the seedlings are maintained on selection medium.

제안 방법

Two methods of the Agrobacterium-mediated transfor mation of Arabidopsis were developed and used for this study. One is the root-explants transformation method which employs a direct shooting media containing BA and IAA[18].

대상 데이터

seedlings con taining single copy and multi-copy T-DNA was inves tigated in T3 generation. Single copy T-DNA lines used in this experiment were 3 lines (R17, R53, R68) which were randomly sheeted. These lines had a sinele copy of T-DNA which was determined by segregation ratio of kan resistance/ and did not show GUS inactivation in their T2 generation (table 1).
The gene-specific primers for amplifying the GUS gene fragment (primer Pl and P2), and NPTI1 (primer P3 and P4) were designed and used for PCR The sequence of primers are as follows (P1, ACGAACTGAACTGGCA- GACTATCCCC; P2, CGTACCT CGCATTACCCTTACGCT; P3, ACTCGGGAGCGGCGATACTGTA; P4, GAGGCTAT- TCGGCTATGACTG). The reaction was carried out in a total volume of 100μl that contained 0.2mM of each deoxynucleotide, 0.5μg of each primer, 2 unit of Taq polymerase and approximate 100 ng of Arabidopsis DNA, and was overlaid with 50111 of mineral oil. Plant DNA for PCR was extracted from leaves according to the method of Dellaporta[3].

성능/효과

In order to verify the presence of T-DNA in genomic DNA from kan^R seedlings with no detectable GUS activity, PCR analysis was conducted. In all PCR reactions using four specific primers; two (Pl and P2) for recognizing coding sequence of GUS gene, and two (P3 and P4) for NPTII gene, the results indicated that kan^R seedlings contained GUS and NPTII gene in their genome, even if they did not have GUS activity (data not shown).
However GUS gene inactivated seedlings were found in one of eight lines which contained single copy T-DNA. In conclusion, GUS geme inactivation was much higher in multi-copy T-DNA lines (GUS inacti vation frequency 7/121 = 5.8%) than in single T-DNA containing lines (2/275 = 0.7%).
also demonstrated that inactivation of the introduced foreign gene in transgenic petunia plants was associated with increased methylation of sites within the 35S promoter preferentially [15]. It may thus be concluded that the GUS gene containing CaMV 35S promoter is probably more sensitive to methylation than the nptll gene containing nos promoter in lines transformed with pBI121. However the mechanism of deferential methylation remains unrevealed.
The cause of these results that nptll gene is less sensitive to methylation, appears to be the effect of election pressure when the seedlings are maintained on selection medium. The experimental result indicated that GUS gene inactivation occurred frequently in plants with multicopy integration of the transgene. It has become obvious from published reports that copy number of the introduced T-DNA affect on gene expression negatively and multiple insertions tended to have increased methylation of the integrated T-DNA [5,15,21].
By investigating GUS gene inactivation from kanamycin resistant T2 and T3 progeny seedlings of transgenic Arabidopsis lines, the stability of transgene was evaluated over generation. These experimental results show strong evidence that the expression of transgene is decreased gradually when generation is proceed from T2 to T3 and that this inactivation is more severe in multi-copy T-DNA line than in single copy.

참고문헌 (16)

Bochardt, Anja, Hodal, Lene, Palmgren, Gorm, Mattsson, Ole, Okkels, Finn T.. DNA Methylation Is Involved in Maintenance of an Unusual Expression Pattern of an Introduced Gene. Plant physiology, vol.99, no.2, 409-414.

상세보기
Chang, Seok So, Park, Soon Ki, Kim, Byung Chul, Kang, Bong Joong, Kim, Dal Ung, Nam, Hong Gil. Stable genetic transformation of Arabidopsis thaliana by Agrobacterium inoculation in planta. The Plant journal : for cell and molecular biology, vol.5, no.4, 551-558.

상세보기
Dellaporta, Stephen L., Wood, Jonathan, Hicks, James B.. A plant DNA minipreparation: Version II. Plant molecular biology reporter, vol.1, no.4, 19-21.

상세보기
10.1038/nbt0994-883
Hobbs, Shaun L. A., Kpodar, Pascal, DeLong, Catherine M. O.. The effect of T-DNA copy number, position and methylation on reporter gene expression in tobacco transformants. Plant molecular biology, vol.15, no.6, 851-864.

상세보기
Hobbs, Shaun L. A., Warkentin, Thomas D., DeLong, Catherine M. O.. Transgene copy number can be positively or negatively associated with transgene expression. Plant molecular biology, vol.21, no.1, 17-26.

상세보기
Jefferson, Richard A.. Assaying chimeric genes in plants: The GUS gene fusion system. Plant molecular biology reporter, vol.5, no.4, 387-405.

상세보기
Jorgensen, R.. Altered gene expression in plants due totrans interactions between homologous genes. Trends in biotechnology, vol.8, 340-344.

상세보기
Klaas, Manfred, John, Manorama C., Crowell, Dring N., Amasino, Richard M.. Rapid induction of genomic demethylation and T-DNA gene expression in plant cells by 5-azacytosine derivatives. Plant molecular biology, vol.12, no.4, 413-423.

상세보기
Kooter, J.M., Mol, J.N.M.. Trans-inactivation of gene expression in plants. Current opinion in biotechnology, vol.4, no.2, 166-171.

상세보기
Linne, F., Heidmann, I., Saedler, H., Meyer, P.. Epigenetic changes in the expression of the maize A1 gene inPetunia hybrida: Role of numbers of integrated gene copies and state of methylation. Molecular & general genetics : MGG, vol.222, no.2, 329-336.

상세보기
Ottaviani, M.-P., Smits, T., Hanisch ten Cate, C.H.. Differential methylation and expression of the β-glucuronidase and neomycin phosphotransferase genes in transgenic plants of potato cv. Bintje. Plant science, vol.88, no.1, 73-81.

상세보기
Palmgren, Gorm, Mattson, Ole, Okkels, Finn Thyge. Treatment of Agrobacterium or leaf disks with 5-azacytidine increases transgene expression in tobacco. Plant molecular biology, vol.21, no.3, 429-435.

상세보기
Register III, James C., Peterson, David J., Bell, Philip J., Bullock, W. Paul, Evans, Ian J., Frame, Bronwyn, Greenland, Andrew J., Higgs, Nicole S., Jepson, Ian, Jiao, Shuping, Lewnau, Carol J., Sillick, Jeff M., Wilson, H. Martin. Structure and function of selectable and non-selectable transgenes in maize after introduction by particle bombardment. Plant molecular biology, vol.25, no.6, 951-961.

상세보기
Renckens, Suzy, De Greve, Henri, Van Montagu, Marc, Hernalsteens, Jean-Pierre. Petunia plants escape from negative selection against a transgene by silencing the foreign DNA via methylation. Molecular & general genetics : MGG, vol.233, no.1, 53-64.

상세보기
Rogers, Sally W., Rogers, John C.. The importance of DNA methylation for stability of foreign DNA in barley. Plant molecular biology, vol.18, no.5, 945-961.

상세보기

저자의 다른 논문 :

표제어: PCR

동의어: Packet Collision Rate

용어 설명 출처 목록 (6)

용어 설명: PCR은 세균 특이성이 있는 primer를 이용하여 적은 수의 세균이 있을지라도 쉽게 검출할 수 있는 유용한 방법이며, 이를 이용하여 구강 내 치면세균막이나 타액에서 직접 세균을 검출할 수 있게 되었다[8].

내보내기 구분	파일저장 인쇄 메일전송
구성항목	기본정보 상세정보 관리번호, 논문명, 저널/프로시딩명, 저자 , 발행년, 권, 호, 시작페이지, 끝페이지, 발행기관 관리번호, 논문명, 대등논문명, 저자 , 저널/프로시딩명, 발행기관, 발행년, 발행언어, 권, 호, 시작페이지, 끝페이지, ISBN, ISSN, 주제분야, 키워드, 초록(한글), 초록(영문), 저자(소속기관)
저장형식	Text(ASCII format) Excel format RefWorks Direct Export RIS format (for Reference Manager, ProCite, EndNote), Scholar's Aids, Mendeley
메일정보	받는사람 (필수) @ 보내는사람 (선택) @ 제목 내용 KISTI 검색결과 이메일 서비스
안내	총 건의 자료가 검색되었습니다. 다운받으실 자료의 인덱스를 입력하세요. (1-10,000) 검색결과의 순서대로 최대 10,000건 까지 다운로드가 가능합니다. 데이타가 많을 경우 속도가 느려질 수 있습니다.(최대 2~3분 소요) 다운로드 파일은 UTF-8 형태로 저장됩니다. 파일의 내용이 제대로 보이지 않을실 때는 웹브라우저 상단의 보기 -> 인코딩 -> 자동선택 여부를 확인하십시오. ~ Text(ASCII format) Excel format

연합인증