[논문]Purification and Characterization of Repressor of Temperate S. aureus Phage Φ11

Das, Malabika; Ganguly, Tridib; Chattoraj, Partho; Chanda, Palas Kumar; Bandhu, Amitava; Lee, Chia Yen; Sau, Subrata

doi:10.5483/bmbrep.2007.40.5.740

Purification and Characterization of Repressor of Temperate S. aureus Phage Φ11 원문보기

Journal of biochemistry and molecular biology = 한국생화학회지, v.40 no.5, 2007년, pp.740 - 748

Das, Malabika (Department of Biochemistry, Bose Institute) , Ganguly, Tridib (Department of Biochemistry, Bose Institute) , Chattoraj, Partho (Department of Biochemistry, Bose Institute) , Chanda, Palas Kumar (Department of Biochemistry, Bose Institute) , Bandhu, Amitava (Department of Biochemistry, Bose Institute) , Lee, Chia Yen (Department of Microbiology and Immunology, University of Arkansas for Medical Sciences) , Sau, Subrata (Department of Biochemistry, Bose Institute)

Abstract ▼ AI-Helper

To gain insight into the structure and function of repressor proteins of bacteriophages of gram-positive bacteria, repressor of temperate Staphylococcus aureus phage ${\phi}11$ was undertaken as a model system here and purified as an N-terminal histidine-tagged variant (His-CI) by affinity chromatography. A ~19 kDa protein copurified with intact His-CI (~ 30 kDa) at low level was resulted most possibly due to partial cleavage at its Ala-Gly site. At ~10 nM and higher concentrations, His-CI forms significant amount of dimers in solution. There are two repressor binding sites in ${\phi}11$ cI-cro intergenic region and binding to two sites occurs possibly by a cooperative manner. Two sites dissected by HincII digestion were designated operators $O_L$ and $O_R$, respectively. Equilibrium binding studies indicate that His-CI binds to $O_R$ with a little more strongly than $O_L$ and binding species is probably dimeric in nature. Interestingly His-CI binding affinity reduces drastically at elevated temperatures ($32-42^{\circ}C$). Both $O_L$ and $O_R$ harbor a nearly identical inverted repeat and studies show that ${\phi}11$ repressor binds to each repeat efficiently. Additional analyses indicate that ${\phi}11$ repressor, like $\lambda$ repressor, harbors an N-terminal domain and a C-terminal domain which are separated by a hinge region. Secondary structure of ${\phi}11$ CI even nearly resembles to that of $\lambda$ phage repressor though they differ at sequence level. The putative N-terminal HTH (helix-turn-helix) motif of ${\phi}11$ repressor belongs to the HTH -XRE-family of proteins and shows significant identity to the HTH motifs of some proteins of evolutionary distant organisms but not to HTH motifs of most S. aureus phage repressors.

주제어

AI 본문요약
AI-Helper

* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.

제안 방법

0), 5% glycerol, and 1 mM EDTA] followed by incubation of reaction mixture on ice for 20 min. Next, samples were successively analyzed by native polyacrylamide gel electrophoresis and densitometric scanning of gel autoradiographs.
To clone the putative repressor protein encoding gene of temperate phage φ11, a polymerase chain reaction was carried out by Taq polymerase with φ11 genomic DNA as template and pair of primers PCI4 (5'-AAGCTTAGGCGCTATTAATCAC) and PCI5 (5'-GAAT TCAAAATGGATAAAAAAGAATTAG). The resulting 748 bp fragment was cloned into pGEMT-Easy cloning vector according to the manufacturer’s protocol (Promega Biotech).
To study the structure and function of φ11 repressor at length, it was cloned, overexpressed in E. coli (pSAU1220) cells, and purified as an N-terminal histidine tagged variant (His-CI) by single step affinity chromatography. Nearly equal amount of protein from each fraction of affinity chromatography, cell debris, and uninduced E.

대상 데이터

edu). Putative inverted repeats in DNA sequence was searched by a program designated EINVERTED (http://npsa-pbil.ibcp.fr). Secondary structural data of different phage repressor proteins presented here were predicted by Jpred server (http://www.
(A) Sequence of cI-cro intergenic region (designated O_LO_R) of φ11. The O_LO_R DNA was digested by HincII and the resulting 117 bp HincII-BamHI (designated O_R) and 153 bp HincII-EcoRI (designated O_L) DNA fragments were purified. All three fragments had been utilized in gel shift assay separately.

이론/모형

Analytical gel filtration chromatography was performed according to standard procedure (Ausubel et al., 1998) in an HPLC system using a gel filtration column Protein Pak (3000 sw). Both HPLC system and column had been purchased from Waters.
To identify the oligomeric status of φ11 repressor in solution analytical gel filtration chromatography was carried out with His-CI according to standard techniques. As shown in Fig.
uk/clustalw). Using all the HTH motifs described here, a dendrogram was constructed by ClustalW program with neighbor-joining setting. Putative promoter elements including transcription start site was determined according to a program NNPP (http://searchlauncher.

참고문헌 (31)

Aggarwal, A. K., Rodgers, D. W., Drottar, M., Ptashne, M. and Harrison, S. C. (1988) Recognition of a DNA operator by the repressor of phage 434: a view at high resolution. Science 242, 899-907.

상세보기
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. and Struhl, K. (ed) (1998) In Current Protocols in Molecular Biology, Vol. 2, pp. 10.0.1-10.22.24 and pp. 12.0.1-12.2.11 copyright by John Wiley & Sons, Inc., USA.
Ballivet, M. and Eisen, H. (1978) Purification and properties of phage P22 c2 repressor. Eur. J. Biochem. 82, 175-80.

상세보기
Beamer, L. J., Pabo, C. and Refined, O. (1992) 1.8 A crystal structure of the lambda repressor-operator complex, J. Mol. Biol. 227, 177-196.

상세보기
Carroll, D., Kehoe, M., Cavanagh, A. D. and Coleman, D. C. (1995) Novel organization of the site-specific integration and excision recombination functions of the Staphylococcus aureus serotype F virulence-converting phages phi 13 and phi 42. Mol. Microbiol. 16, 877-893.

상세보기
Christensen, A. C. (2001) Bacteriophage lambda-based expression vectors. Mol. Biotechnol. 17, 219-224.

상세보기
Daniels, D. L., Schroeder, J. I., Szybalski, W., Sanger, F., Coulson, A. R , Hong, G. F., Hill, D. F., Petersen, G. F. and Blattner, F. R. (1983) Lysogenic induvtion in Lambda II. P. pp. 123-144, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., USA.
Ganguly, T., Chanda, P. K., Bandhu, A., Chattoraj, P., Das, M. and Sau, S. (2006) Effects of physical, ionic, and structural factors on the binding of repressor of mycobacteriophage L1 to its cognate operator DNA. Protein Peptide Lett. 13, 793-798.

상세보기
Ganguly, T., Chattoraj, P., Das, M., Chanda, P. K., Mandal, N. C. and Sau, S. (2004) A point mutation at the C-terminal half of the repressor of temperate mycobacteriophage L1 affects its binding to the operator DNA, J. Biochem. Mol. Biol. 37, 709-714.

원문보기 상세보기
Iandolo, J. J., Worrell, V., Groicher, K. H., Qian, Y., Tian, R., Kenton, S., Ji Dorman, A. H., Lin, S., Loh, P., Qi, S., Zhu, H. and Roe, B. A. (2002) Comparative analysis of the genomes of the temperate bacteriophages phi 11, phi 12 and phi 13 of Staphylococcus aureus 8325. Gene 289, 109-118.

상세보기
Kaneko, J., Kimura, T., Narita, S., Tomita, T. and Kamio, Y. (1998) Complete nucleotide sequence and molecular characterization of the temperate staphylococcal bacteriophage phiPVL carrying Panton-Valentine leukocidin genes, Gene 215, 57-67.

상세보기
Koblan, K. S. and Ackers, G. K. (1991) Energetics of subunit dimerization in bacteriophage lambda cI repressor: linkage to protons, temperature, and KCl, Biochemistry 30, 7817-7821.

상세보기
Koudelka, A. P., Hufnagel, L. A. and Koudelka, G. B. (2004) Purification and characterization of the repressor of the shiga toxin-encoding bacteriophage 933W: DNA binding, gene regulation, and autocleavage. J. Bacteriol. 186, 7659-7669.

상세보기
Kwan, T., Liu, J., DuBow, M., Gros, P. and Pelletier, J. (2005) The complete genomes and proteomes of 27 Staphylococcus aureus bacteriophages. Proc. Natl. Acad. Sci. USA 102, 5174-5179.

상세보기
Lee, C. Y. and Iandolo J. J. (1986) Integration of staphylococcal phage L54a occurs by site-specific recombination: structural analysis of the attachment sites Proc. Natl. Acad. Sci. USA 83, 5474 -5478.

상세보기
Lee, C. Y. and Iandolo J. J. (1988) Structural analysis of staphylococcal bacteriophage phi 11 attachment sites. J. Bacteriol. 170, 2409-2411.

상세보기
Lee, C. Y. and Buranen, S. L. (1989) Extent of the DNA sequence required in integration of staphylococcal bacteriophage L54a. J. Bacteriol. 171, 1652-1657.

상세보기
Little, J. W. (1984) Autodigestion of lexA and phage lambda repressors. Proc. Natl. Acad. Sci. USA 81, 1375-1379.

상세보기
Mandal, N. C. and Leib, M. (1976) Heat-sensitive DNA-binding activity of the cI product of bacteriophage lambda. Molec. Gen. Genet. 146, 299-302.

상세보기
Martin, M. C., Alonso, J. C. Suarez, J. E. and Alvarez, M. A. (2000) Generation of food-grade recombinant lactic acid bacterium strains by site-specific recombination. Appl. Environ. Microbiol. 66, 2599-2604.

상세보기
Narita, S., Kaneko, J., Chiba, J., Piemont, Y., Jarraud, S., Etienne, J. and Kamio, Y. (2001) Phage conversion of Panton-Valentine leukocidin in Staphylococcus aureus: molecular analysis of a PVL-converting phage, phiSLT. Gene 268, 195-206.

상세보기
Nohmi, T. J., Battista, R., Dodson, L. A. and Walker, G. C. (1988) RecA-mediated cleavage activates UmuD for mutagenesis: mechanistic relationship between transcriptional derepression and posttranslational activation. Proc. Natl. Acad. Sci. USA 85, 1816-1820.

상세보기
Oppenheim, A. B., Kobiler, Stavans, O. J., Court, D. L. and Adhya, S. (2005) Switches in bacteriophage lambda development. Annu. Rev. Genet. 39, 409-429.

상세보기
Ptashne, M. (1986) Protein-DNA interactions and gene control in A genetic switch. pp. 33-47. Blackwell Press, PaloAlto, Calif.
Sambrook, J. and Russell, D. W. (2001) In Molecular Cloning: A Laboratory Manual. 3rd ed., Cold Spring Harbor Laboratory Press, CSH, New York, USA.
Shaner, S. L. and Gaissarian, E. S. (1996) Binding of Escherichia coli LexA repressor to the RecA operator. J. Mol. Recognit. 9, 468-473.

상세보기
Sumby, P. and Waldor, M. K. (2003) Transcription of the toxin genes present within the Staphylococcal phage phiSa3ms is intimately linked with the phage's life cycle. J. Bacteriol. 185, 6841-6851.

상세보기
Vershon, A. K., Liao, S. M., McClure, W. R. and Sauer, R. T. (1987) Bacteriophage P22 Mnt repressor. DNA binding and effects on transcription in vitro. J. Mol. Biol. 195, 311-322.

상세보기
Whitson, P. A., Olson, J. S. and Matthews, K. S. (1986) Thermodynamic analysis of the lactose repressor-operator DNA interaction. Biochemistry 25, 3852-3858.

상세보기
Yamaguchi, T., Hayashi, T., Takami, H., Nakasone, K., Ohnishi, M., Nakayama, K., Yamada, S., Komatsuzawa, H. and Sugai, M. (2000) Phage conversion of exfoliative toxin A production in Staphylococcus aureus. Mol. Microbiol. 38, 694-705.

상세보기
Ye, Z. H. and Lee, C. Y. (1989) Nucleotide sequence and genetic characterization of staphylococcal bacteriophage L54a int and xis genes. J. Bacteriol. 171, 4146-4153.

상세보기

표제어: PCR

동의어: Packet Collision Rate

용어 설명 출처 목록 (6)

용어 설명: PCR은 세균 특이성이 있는 primer를 이용하여 적은 수의 세균이 있을지라도 쉽게 검출할 수 있는 유용한 방법이며, 이를 이용하여 구강 내 치면세균막이나 타액에서 직접 세균을 검출할 수 있게 되었다[8].

내보내기 구분	파일저장 인쇄 메일전송
구성항목	기본정보 상세정보 관리번호, 논문명, 저널/프로시딩명, 저자 , 발행년, 권, 호, 시작페이지, 끝페이지, 발행기관 관리번호, 논문명, 대등논문명, 저자 , 저널/프로시딩명, 발행기관, 발행년, 발행언어, 권, 호, 시작페이지, 끝페이지, ISBN, ISSN, 주제분야, 키워드, 초록(한글), 초록(영문), 저자(소속기관)
저장형식	Text(ASCII format) Excel format RefWorks Direct Export RIS format (for Reference Manager, ProCite, EndNote), Scholar's Aids, Mendeley
메일정보	받는사람 (필수) @ 보내는사람 (선택) @ 제목 내용 KISTI 검색결과 이메일 서비스
안내	총 건의 자료가 검색되었습니다. 다운받으실 자료의 인덱스를 입력하세요. (1-10,000) 검색결과의 순서대로 최대 10,000건 까지 다운로드가 가능합니다. 데이타가 많을 경우 속도가 느려질 수 있습니다.(최대 2~3분 소요) 다운로드 파일은 UTF-8 형태로 저장됩니다. 파일의 내용이 제대로 보이지 않을실 때는 웹브라우저 상단의 보기 -> 인코딩 -> 자동선택 여부를 확인하십시오. ~ Text(ASCII format) Excel format

연합인증