[논문]Development of a Virus Elution and Concentration Procedure for Detecting Norovirus in Cabbage and Lettuce

Moon, Aerie; Hwang, In-Gyun; Choi, Weon-Sang

Development of a Virus Elution and Concentration Procedure for Detecting Norovirus in Cabbage and Lettuce 원문보기

Food science and biotechnology, v.18 no.2, 2009년, pp.407 - 412

Moon, Aerie (Department of Biotechnology, Dongguk University) , Hwang, In-Gyun (Department of Food Microbiology, Korea Food & Drug Administration) , Choi, Weon-Sang (Department of Biotechnology, Dongguk University)

Abstract ▼ AI-Helper

In this study, a rapid and efficient concentrating procedure that can be used for detecting viruses in vegetables was developed. The Sabin strain of poliovirus type 1 was used to evaluate the efficiency of virus recovery. The procedure included: (a) elution with 0.25 M threonine-0.3 M NaCl pH 9.5; (b) polyethylene glycol (PEG) 8000 precipitation; (c) chloroform extraction; (d) 2$^{nd}$ PEG precipitation; (f) RNA extraction; (g) reverse transcription-polymerase chain reaction (RT-PCR) combined with semi-nested PCR. The overall recoveries by elution/concentration were 29.0% from cabbage and 13.7% from lettuce. The whole procedure usually takes 18 hr. The overall detection sensitivity was 100 RT-PCR units of genogroup II norovirus (GII NoV)/25 g cabbage and 100 RT-PCR units of GII NoV/10 g lettuce. The virus detecting method developed in this study should facilitate the detection of low levels of NoV in cabbage and lettuce.

주제어

AI 본문요약
AI-Helper

* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.

제안 방법

In this study, we adapted a previously developed procedure for detection of virus from oyster samples and modified the eluting and concentrating conditions to allow for efficient recovery of virus from vegetables. The elution and concentration procedures developed in this study can be performed in less than 18 hr and when coupled with realtime RT-PCR can yield quantitative results within 24 hr.
In this study, we adapted the procedures developed for detecting NoV in oysters (26-28) and modified the procedures using poliovirus as a surrogate for NoV (12,16,18,22). Although the plaque assay is more convenient for the evaluation of virus recoveries than RT-PCR, there is no plaque assay available for NoV.
Inoculation of cabbage and lettuce Cabbage and lettuce were purchased at a local supermarket (Samsung TESCO Home Plus, Gyeongju, Korea) and tested negative for the poliovirus and NoV with PCR. Individual cabbage leaves (ca.
5);2) extraction with 75 mL of chloroform:isoamyl alcohol (24:1);3) virus precipitation with PEG 8000 (ECP). Poliovirus was inoculated on 25 g of cabbage or 10 g of lettuce, processed by 2 procedures and then evaluated by RT-PCR. As indicated by the results, an initial seeding with as few as 100 PFU poliovirus were consistently detected from cabbage leaves by the 2 described methods, but a much stronger band was observed by EPCP (Fig.
Comparison of 2 concentration procedure prior to RNA amplification Based on the initial procedural results, additional procedures to elute and concentrate viruses from the vegetable leaves were developed. The established procedure in this study was adapted from the method applied to the shellfish (26,28), that is, elution-PEG precipitationchloroform- PEG precipitation (EPCP). The procedure includes 2 PEG precipitation steps, and we could not recover all the viruses after PEG precipitation.
Poliovirus recovery from cabbage and lettuce by elution and concentrating procedure Poliovirus recoveries were evaluated by plaque assay. The recovery procedure included elution, 1^st PEG precipitation, solvent extraction (chloroform: isoamyl alcohol 24:1), and 2^nd PEG precipitation. All steps were performed at least 3 times as independent trials and recoveries were calculated based on the titer of the added poliovirus stock as 100%.

대상 데이터

Cell culture and viruses The NoVs used in this study were obtained from the Division of Enteric and Hepatitis Viruses, National Institute of Health, Seoul, Korea. The NoV titer in RT-PCR units was determined by endpoint dilutions.
The RT-PCR mixture contained 8 μL of one-step RTPCR premix, 100 pmol sense primer (GII-F1M: GGGAGGGCGATCGCAATCT for GII NoV; DG172: GATTACAAGGATGGTACGCTTACA for poliovirus) and 200 pmol antisense primer (GII-R1M: CCRCCIGCATRICCRTTRTACAT for GII NoV; DG173: GACTCTATGTAATTGGTGATGCCT for poliovirus).

성능/효과

Poliovirus was inoculated on 25 g of cabbage or 10 g of lettuce, processed by 2 procedures and then evaluated by RT-PCR. As indicated by the results, an initial seeding with as few as 100 PFU poliovirus were consistently detected from cabbage leaves by the 2 described methods, but a much stronger band was observed by EPCP (Fig. 3). As few as 100 PFU poliovirus were repeatedly detected (though it is a faint band) on lettuce by EPCP, but 100 PFU poliovirus was not detected by ECP, meaning the performance of EPCP is better than that of ECP (Fig.

후속연구

5) was the best buffer among those tested for the elution of poliovirus from cabbage and lettuce. However, further experiments on the effect of ionic strength, pH, and the presence of Mg²⁺ ions in buffers are needed for more efficient elution of viruses from various food matrices.
The elution and concentration procedures developed in this study can be performed in less than 18 hr and when coupled with realtime RT-PCR can yield quantitative results within 24 hr. The virus-detection method developed in this study should facilitate detection of low levels of NoV in cabbage and lettuce. This method should also be applicable to other kinds of enteric viruses, including HAV, in cabbage and lettuce.

참고문헌 (37)

Koopmans M, von Bonsdorff C, Vinje J, de Medici D, Monroe S. Foodborne viruses. FEMS Microbiol. Rev. 26: 187-205 (2002)

상세보기
Koopmans M, Duizer E. Foodborne viruses: An emerging problem. Int. J. Food Microbiol. 90: 23-41 (2004)

상세보기
Green KY, Chanock RM, Kapikian AZ. Human caliciviruses. pp. 841-874. In: Fields Virology. 4th ed. Knipe DM, Howley PM, Grinnin DE, Lamb RA, Martin MA, Roizman B, Strauss SE (eds). Lippinocott Williams & Wilkins, Philadelphia, PA, USA (2001)
Kageyama T, Shinohara M, Uchida K, Fukushi S, Hoshino FB, Kojima S, Takai R, Oka T, Takeda N, Katayama K. Coexistence of multiple genotypes, including newly identified genotypes, in outbreaks of gastroenteritis due to norovirus in Japan. J. Clin. Microbiol. 42: 2888-2905 (2004)
CDC Fact sheet. Norovirus in healthcare facilities. Available from:http://www.cdc.gov/ncidod/dhqp/id_norovirusFS.html. Accessed July 18, 2005
Zheng D, Ando TM, Fankhauser RL, Beard RS, Glass RI, Monroe SS. Norovirus classification and proposed strain nomenclature. Virology 346: 312-323 (2006)

상세보기
Hutson AM, Atmar RL, Estes MK. Norovirus disease: Changing epidemiology and host susceptibility factors. Trends Microbiol. 12:279-287 (2004)

상세보기
Wang Q, Costantini V, Saif LJ. Porcine enteric caliciviruses: Genetic and antigenic relatedness to human caliciviruses, diagnosis, and epidemiology. Vaccine 25: 5453-5466 (2007)

상세보기
Hedberg CW, Osterholm MT. Outbreaks of food-borne and waterborne viral gastroenteritis. Clin. Microbiol. Rev. 6: 199-210 (1993)

상세보기
Schwab KJ, Neill FH, Fankhauser RL, Daniels NA, Monroe SS, Bergmire-Sweat DA, Estes M, Atmar RL. Development of methods to detect 'Norwalk-like viruses' (NLVs) and hepatitis A virus in delicatessen foods: Application to a food-borne NLV outbreak. Appl. Environ. Microb. 66: 213-218 (2000)

상세보기
Sair AI, D'Souza DH, Moe CL, Jaykus LA. Improved detection of human enteric viruses in foods by RT-PCR. J. Virol. Methods 100:57-69 (2002)

상세보기
Le Guyader FS, Schultz A, Haugarreau L, Croci L, Manula L, Duizer E, Lodder-Verschoor F, von Bonsdorff C, Suffredin E, van der Poel WMM, Reymundo R, Koopmans M. Round-robin comparison of the methods for the detection of human enteric viruses in lettuce. J. Food Protect. 67: 2315-2319 (2004)

상세보기
Thornton AC, Jennings-Conklin KS, McCormick MI. Noroviruses:

상세보기
Guevremont E, Brassard J, Houde A, Simard C, Trottier Y. Development of an extraction and concentration procedure and comparison of RT-PCR primer systems for the detection of hepatitis A virus and norovirus GII in green onions. J. Virol. Methods 134:130-135 (2006)

상세보기
Bidawid S, Farber JM, Sattar SA. Rapid concentration and detection of hepatitis A virus from lettuce and strawberries. J. Virol. Methods 88: 175-185 (2000)

상세보기
Dubois E, Agier C, Traore O, Hennechart C, Merle G, Cruciere C, Laveran H. Modified concentra method for the detection of enteric viruses on fruits and vegetables by reverse transcriptase-polymerase chain reaction or cell culture. J. Food Protect. 65: 1962-1969 (2002)

상세보기
Rzezutka A, D'Agostino M, Cook N. An ultracentrifugation-based approach to the detection of hepatitis A virus in soft fruits. Int. J. Food Microbiol. 108: 315-320 (2006)

상세보기
Dubois E, Hennechart C, Deboosere N, Merle G, Legeay O, Burger C, Le Calve M, Lombard B, Ferre V, Traore O. Intra-laboratory validation of a concentration adapted for the enumeration of infectious F-specific RNA coliphage, enterovirus, and hepatitis A virus from inoculated leaves of salad vegetables. Int J. Food Microbiol. 108: 164-171 (2006)

상세보기
Dubois E, Hennechart C, Ghislaine M, Burger C, Hmila N, Ruelle S, Perelle S, Ferrc V. Detection and quantification by real-time RTPCR of hepatitis A virus from inoculated tap waters, salad vegetables, and soft fruits: Characterization of the method performances. Int. J. Food Microbiol. 117: 141-149 (2007)

상세보기
Lee S, Jang K, Woo G, Kwak H, Kim K. Development of protocol for the effective detection of feline calicivirus as norovirus surrogate in oyster and lettuce. Korean J. Food Sci. Technol. 39: 71-76 (2007)
Papafragkou E, Plante M, Mattison K, bidawid S, Krthikeyan K, Farber JM, Jaykus L. Rapid and sensitive detection of hepatitis A virus in representative food matrices. Int. J. Food Microbiol. 147:177-187 (2008)
Love DC, Casteel MJ, Meschke JS, Sobsey MD. Methods for recovery of hepatitis A virus (HAV) and other viruses from processed foods and detection of HAV by nested RT-PCR and TaqMan RT-PCR. Int. J. Food Microbiol. 126: 221-226 (2008)

상세보기
Kim SR, Kim D, Kwon K, Hwang I, Oh M. Detection of norovirus in contaminated ham by reverse transcriptase-PCR and nested PCR. Food Sci. Biotechnol. 17: 651-654 (2008)

원문보기 상세보기
Baert L, Uyttendaele M, Debevere J. Evaluation of viral extraction methods on a broad range of ready-to-eat foods with conventional and real-time RT-PCR for Norovirus GII detection. Int. J. Food Microbiol. 123: 101-108 (2008)

상세보기
Shieh YC, Calci KR, Baric RS. A method to detect low levels of enteric viruses in contaminated oysters. Appl. Environ. Microb. 65:4709-4714 (1999)

상세보기
Mullendore JL, Sobsey MD, Shieh YC. Improved method for the recovery of hepatitis A virus from oysters. J. Virol. Methods 94: 25-35 (2001)

상세보기
Ha S, Woo G, Kwak H, Hwang I, Choi WS. Simplified procedure for detection of poliovirus and norovirus in oysters. Korean J. Food Sci. Technol. 37: 1018-1023 (2005)
Jee Y. Establishment of detection method for norovirus. Technical report. pp. 16-17. Korea Food & Drug Administration, Seoul, Korea (2005)
Kojima S, Kageyama T, Fukushi S, Hoshino F, Shinohara M, Uchida K, Natori K, Takeda N, Katayama K. Group-specific PCR primers for detection of Norwalk-like viruses. J. Virol. Methods 100: 107-114 (2002)

상세보기
Kim S, Cheon D, Kim J, Lee D, Jheong W, Heo Y, Chung H, Jee Y, Lee J. Outbreaks of gastroenteritis that occurred during school excursions in Korea were associated with several waterborne strains of norovirus. J. Clin. Microbiol. 43: 4836-4839 (2005)

상세보기
Hernandez FR, Monge C, Jimenez C, Taylor L. Rotavirus and hepatitis A virus in market lettuce (Latuca savita) in Costa Rica. Int. J. Food Microbiol. 37: 221-223 (1997)

상세보기
Ward BK, Chenoweth CM, Irving LG. Recovery of viruses from vegetable surfaces. Appl. Environ. Microb. 44: 1389-1394 (1982)

상세보기
Leggit PR, Jaykus LA. Detection methods for human enteric viruses in the representative foods. J. Food Protect. 63: 1738-1744 (2000)

상세보기
Butot S, Putallaz T, Sanchez G. Procedure for rapid concentration and detection of enteric viruses from berries and vegetables. Appl. Environ. Microb. 73: 186-192 (2007)

상세보기
Le Guyader FS, Neill FH, Dubois E, Bon F, Loisy F, Kohli E, Pommepuy M, Atmar RL. A semiquantitative approach to estimate Norwalk-like virus contamination of oysters implicated in an outbreak. Int. J. Food Microbiol. 87: 107-112 (2003)

상세보기
Rueckert RR. Picornaviridae: The viruses and their replication. pp. 609-654. In: Fields Virology. Fields BN, Knipe DM, Howley PM (eds). Lippincott-Raven Pub. Philadelphia, PA, USA (1996)
Atmar RL, Neill FH, Romalde JL, Guyader FL, Woodley CM, Metcalf TG, Estes MK. Detection of Norwalk virus and hepatitis A virus in shellfish tissues with the PCR. Appl. Environ. Microb. 61:3014-3018 (1995)

상세보기

저자의 다른 논문 :

표제어: PCR

동의어: Packet Collision Rate

용어 설명 출처 목록 (6)

용어 설명: PCR은 세균 특이성이 있는 primer를 이용하여 적은 수의 세균이 있을지라도 쉽게 검출할 수 있는 유용한 방법이며, 이를 이용하여 구강 내 치면세균막이나 타액에서 직접 세균을 검출할 수 있게 되었다[8].

내보내기 구분	파일저장 인쇄 메일전송
구성항목	기본정보 상세정보 관리번호, 논문명, 저널/프로시딩명, 저자 , 발행년, 권, 호, 시작페이지, 끝페이지, 발행기관 관리번호, 논문명, 대등논문명, 저자 , 저널/프로시딩명, 발행기관, 발행년, 발행언어, 권, 호, 시작페이지, 끝페이지, ISBN, ISSN, 주제분야, 키워드, 초록(한글), 초록(영문), 저자(소속기관)
저장형식	Text(ASCII format) Excel format RefWorks Direct Export RIS format (for Reference Manager, ProCite, EndNote), Scholar's Aids, Mendeley
메일정보	받는사람 (필수) @ 보내는사람 (선택) @ 제목 내용 KISTI 검색결과 이메일 서비스
안내	총 건의 자료가 검색되었습니다. 다운받으실 자료의 인덱스를 입력하세요. (1-10,000) 검색결과의 순서대로 최대 10,000건 까지 다운로드가 가능합니다. 데이타가 많을 경우 속도가 느려질 수 있습니다.(최대 2~3분 소요) 다운로드 파일은 UTF-8 형태로 저장됩니다. 파일의 내용이 제대로 보이지 않을실 때는 웹브라우저 상단의 보기 -> 인코딩 -> 자동선택 여부를 확인하십시오. ~ Text(ASCII format) Excel format

연합인증