[국내논문]감귤저장병 병원균 Penicillium digitatum 방제를 위한 길항 내생세균 Bacillus velezensis CB3의 분리 및 특성 규명 Isolation and Characterization of an Antagonistic Endophytic Bacterium Bacillus velezensis CB3 the Control of Citrus Green Mold Pathogen Penicillium digitatum원문보기
대표적인 감귤 녹색곰팡이병(Penicillium digitatum) 방제용 생물농약을 개발하고자 제주도내 7개 과수원으로부터 채집된 citrus 잎에서 21균주의 내생세균을 분리하였다. 그 중 5개의 세균이 녹색곰팡이병균 P. digitatum에 항균활성을 나타냈으며, 대치배양에서 가장 강력한 항균활성을 보인 CB3 균주가 선발되었다. CB3 균주는 간상형의 그람 양성세균으로 생리 생화학적 특성과 gyrA 유전자 염기서열 분석에 의해 Bacillus velezensis로 동정되었다. CB3 균주는 감귤 저장병 병원균 Penicillium digitatum에 강력한 항균활성을 나타내었다. $1{\times}10^5$ spores/ml에 이르는 고농도의 P. digitatum을 감귤에 상처접종했을 때에도, $1{\times}10^8$ cfu/ml의 CB3에 의한 방제효과는 66.7%로 매우 높았다. 본 연구결과, Bacillus velezensis CB3의 안정성과 강한 방제활성 등을 고려할 때 유용 친환경적 방제제로서 매우 가치가 있을 것으로 판단된다.
대표적인 감귤 녹색곰팡이병(Penicillium digitatum) 방제용 생물농약을 개발하고자 제주도내 7개 과수원으로부터 채집된 citrus 잎에서 21균주의 내생세균을 분리하였다. 그 중 5개의 세균이 녹색곰팡이병균 P. digitatum에 항균활성을 나타냈으며, 대치배양에서 가장 강력한 항균활성을 보인 CB3 균주가 선발되었다. CB3 균주는 간상형의 그람 양성세균으로 생리 생화학적 특성과 gyrA 유전자 염기서열 분석에 의해 Bacillus velezensis로 동정되었다. CB3 균주는 감귤 저장병 병원균 Penicillium digitatum에 강력한 항균활성을 나타내었다. $1{\times}10^5$ spores/ml에 이르는 고농도의 P. digitatum을 감귤에 상처접종했을 때에도, $1{\times}10^8$ cfu/ml의 CB3에 의한 방제효과는 66.7%로 매우 높았다. 본 연구결과, Bacillus velezensis CB3의 안정성과 강한 방제활성 등을 고려할 때 유용 친환경적 방제제로서 매우 가치가 있을 것으로 판단된다.
In order to develop environment friendly fungicide for the control of citrus green mold (Penicillium digitatum) using endophytic bacteria, the 21 bacterial isolates were isolated from citrus leaves in seven different orchards in Jeju Province. Among the 21 bacterial isolates, 5 bacterial isolates pr...
In order to develop environment friendly fungicide for the control of citrus green mold (Penicillium digitatum) using endophytic bacteria, the 21 bacterial isolates were isolated from citrus leaves in seven different orchards in Jeju Province. Among the 21 bacterial isolates, 5 bacterial isolates presented antifungal activity against green mold pathogen P. digitatum. The CB3 isolate, which showed the most strong antagonistic effect, was selected through opposite culture against the pathogen. The rod-shaped, gram-positive bacterium CB3 was identified as Bacillus velezensis based on morphological, physiological characteristics, 16S rDNA, and gyr A gene sequence analysis. The isolate CB3 showed strong antifungal activity against two citrus postharvest pathogen P. digitatum. Citrus fruits were treated by wound inoculation with P. digitatum pathogen, and the control efficacy of CB3 culture broth was 66.7% ($1{\times}10^8$ cfu/ml). In conclusion, The stability of CB3 and its strong antifungal activity also lead us to believe that it has potential for application as an environment friendly biological control agent.
In order to develop environment friendly fungicide for the control of citrus green mold (Penicillium digitatum) using endophytic bacteria, the 21 bacterial isolates were isolated from citrus leaves in seven different orchards in Jeju Province. Among the 21 bacterial isolates, 5 bacterial isolates presented antifungal activity against green mold pathogen P. digitatum. The CB3 isolate, which showed the most strong antagonistic effect, was selected through opposite culture against the pathogen. The rod-shaped, gram-positive bacterium CB3 was identified as Bacillus velezensis based on morphological, physiological characteristics, 16S rDNA, and gyr A gene sequence analysis. The isolate CB3 showed strong antifungal activity against two citrus postharvest pathogen P. digitatum. Citrus fruits were treated by wound inoculation with P. digitatum pathogen, and the control efficacy of CB3 culture broth was 66.7% ($1{\times}10^8$ cfu/ml). In conclusion, The stability of CB3 and its strong antifungal activity also lead us to believe that it has potential for application as an environment friendly biological control agent.
* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.
문제 정의
본 연구는 감귤 수확 후 저장 및 수송과정에서 큰 피해를 주고 있는 P. digitatum에 의한 감귤 녹색곰팡이병 방제용 생물농약의 개발을 위하여 강력한 항균활성을 보이는 식물내생세균을 선발하고, 선발된 길항세균에 대한 저장병 방제를 위한 생물농약으로서 실용화 가능성을 모색하고자 하였다.
제안 방법
3시간 뒤 각 처리구별로 CB3의 배양여액, 1 × 106, 1 × 107, 1 × 108 cfu/ml을감귤 표면에 분무하였다.
Citrus속 잎으로부터 21개의 내생세균을 분리하였으며 분리된 내생균을 PDA배지 상에 P. digitatum과 대치배양시켜 길항작용에 의한 저지원 형성을 확인하여 1차 선발하였다. 그 결과 21개의 내생균 중 7개의 균주가 clear zone을 형성하였다.
NA 배지 상에서의 colony 형태분석 및 그람 염색을 수행하여 기본적인 형태적 특징을 파악하고, 최근 형태가 유사한 세균의 분류에 많이 사용되는 API kit(BioMeriex, France)를 이용하여 생화학적 분석을 실시하였다. 그리고 보다 정확한 분석을 위하여 기존 16S rDNA를 증폭하는 Universal Primer 27F/1492R (AGAGTTTGATCMTGGCTCAG/ GGYTACCTTGTTACGACTT)를 이용하여 분석한 결과와 형태적, 생화학적 특성을 토대로 이 유용 내생세균을 일단 Bacillus 속 세균으로 동정하였고, Bacillus 속 세균의 보다 정확한 동정이 가능한 gyr A 유전자를 분석하기 위해 Primer gyrA-f / gyrA-r (CAGTCAGGAAATGCGTACGTCCTT / CAAGGTAATGCTCCAGGCATTGCT)을 이용하였다(Chun and Bae, 2000).
digitatum을 사용하였다. P. digitatum 균사선단부와 길항세균을 2.5 cm간격으로 PDA 배지상에서 대치 배양을 실시하였고 이들을 25 ℃에서 배양한 뒤 길항세균에 의한 식물병원균의 inhibition zone의 길이를 측정하였다. 추가적으로 대표적인 감귤 저장병 병원균 P.
gryA 유전자 증폭을 위해 initial denaturation 94 ℃/5분, denaturation 94 ℃/40초, annealing 55 ℃/40초, extention 72 ℃/1분, final extension 72℃/15분간 실시하였다. PCR 산물은 (주)마크로젠에 sequencing을 의뢰한 후, National Center for Biotechnology Information(NCBI)의 Basic Local Aligment Search tool(BLAST)를 이용하여 DNA 데이터 베이스와 유사한 염기서열을 비교하였다. 염기서열은 PHYDIT program version 3.
3시간 뒤 각 처리구별로 CB3의 배양여액, 1 × 106, 1 × 107, 1 × 108 cfu/ml을감귤 표면에 분무하였다. 그리고 대조약제로 현재 시판되어 감귤 저장병 방제제로 상용화되고 있는 화학농약 스포로곤을 권장 사용농도인 1,000 ppm으로 처리하여 비교하였다. 처리 후, 밀폐된 상태로 23 ℃, 7일 저장한 뒤 발병도와 방제가를 조사하였으며 실험은 3반복으로 수행되었다.
NA 배지 상에서의 colony 형태분석 및 그람 염색을 수행하여 기본적인 형태적 특징을 파악하고, 최근 형태가 유사한 세균의 분류에 많이 사용되는 API kit(BioMeriex, France)를 이용하여 생화학적 분석을 실시하였다. 그리고 보다 정확한 분석을 위하여 기존 16S rDNA를 증폭하는 Universal Primer 27F/1492R (AGAGTTTGATCMTGGCTCAG/ GGYTACCTTGTTACGACTT)를 이용하여 분석한 결과와 형태적, 생화학적 특성을 토대로 이 유용 내생세균을 일단 Bacillus 속 세균으로 동정하였고, Bacillus 속 세균의 보다 정확한 동정이 가능한 gyr A 유전자를 분석하기 위해 Primer gyrA-f / gyrA-r (CAGTCAGGAAATGCGTACGTCCTT / CAAGGTAATGCTCCAGGCATTGCT)을 이용하였다(Chun and Bae, 2000).
길항세균 CB3 균주의 감귤 녹색곰팡이병 방제활성을 검정하기 위해 접종한 감귤에 CB3 균주의 배양여액과 배양액 균주를 처리하였다. 고농도의 감귤 녹색곰팡이병 병원균을 접종한 후 평가되었음에도 불구하고 처리 결과 배양여액에서 55.
℃ 항온기에서 24~48시간 배양하였다. 배양 후 식물체로부터 누출되는 세균을 분리하고, 분리한 균을 새로운 NA배지로 여러 차례 계대하여 단일 콜로니를 분리하였다. 분리한 내생세균과 주요 저장병 병원균인 P.
상처가 없는 감귤(품종: 조생)을 3개의 침으로 1 mm 깊이의 상처를 3반복 주고, 350 ml volume의 플라스틱 용기에 6개씩 넣은 뒤, P. digitatum의 포자현탁액 1 × 105 spores/ml을 감귤 표면에 접종하였다.
한편 pH 6~8의 중성 범위에서 균 생육이 활발하게 일어났으며, 특히 pH 6에서 가장 생육이 우수하였다. 실험 결과를 통해서 pH 6의 molasses broth를 CB3의 최적배양조건으로 결정하였다.
7)를 공시하여 각 배지별 균의 생육을 조사하였다. 전배양액은 LB Broth에 1백금이 접종하여 30 ℃에서 12시간 진탕시켜 준비하였으며, 각 배지에 1%(v/v)되도록 접종하고 이를 진탕배양기 (150 rpm/30 ℃)에서 배양하여 배양액 중의 균체량을 72시간 동안 12시간 간격으로 측정하여(OD값, 600 nm) 생육정도를 확인하였다.
그리고 대조약제로 현재 시판되어 감귤 저장병 방제제로 상용화되고 있는 화학농약 스포로곤을 권장 사용농도인 1,000 ppm으로 처리하여 비교하였다. 처리 후, 밀폐된 상태로 23 ℃, 7일 저장한 뒤 발병도와 방제가를 조사하였으며 실험은 3반복으로 수행되었다.
초기 pH에 따른 영향을 조사하고자 앞서 조사된 기본 배지의 pH를 4~9까지 각각 조정하여 전배양한 길항세균을 접종한 후 30℃, 150 rpm에서 진탕배양하면서 72시간 동안 12시간 단위로 생육정도(OD값, 600 nm)를 조사하였다.
5 cm간격으로 PDA 배지상에서 대치 배양을 실시하였고 이들을 25 ℃에서 배양한 뒤 길항세균에 의한 식물병원균의 inhibition zone의 길이를 측정하였다. 추가적으로 대표적인 감귤 저장병 병원균 P. digitatum 에 대한 길항세균의 항균활성 특성은 대치배양을 통해 inhibition zone이 형성된 부분에 lactophenol을 처리하여고정시킨 다음, 현미경을 통해서 항균활성의 특성분석을 통해 수행되었다.
대상 데이터
그 결과 21개의 내생균 중 7개의 균주가 clear zone을 형성하였다. 그 중 주요 감귤 저장병 병원균 P. digitatum에 강력한 항균활성을 보이며 균주의 생장 또한 빠른 CB3 균주를 실험에 사용할 유용균주로 선발하였다.
길항 내생균의 분리 및 선발
제주도내 7개의 과수원에서 채집한 citrus 잎의 표면을 소독한 후, Nutrient agar(NA) 배지에 각각 3개의 절편을 올려 30℃ 항온기에서 24~48시간 배양하였다. 배양 후 식물체로부터 누출되는 세균을 분리하고, 분리한 균을 새로운 NA배지로 여러 차례 계대하여 단일 콜로니를 분리하였다.
데이터처리
선발된 길항 내생세균 CB3의 감귤 저장병균에 대한 항균 활성능을 평가하기 위해 검정균 P. digitatum을 사용하였다. P.
PCR 산물은 (주)마크로젠에 sequencing을 의뢰한 후, National Center for Biotechnology Information(NCBI)의 Basic Local Aligment Search tool(BLAST)를 이용하여 DNA 데이터 베이스와 유사한 염기서열을 비교하였다. 염기서열은 PHYDIT program version 3.2(Chun, 1995)를 이용 하여 정렬하였고 Neighbor-joining tree는 PHYLIP 3.57c Package(Felsenstein, 1985)를 사용하여 Kimuras 2-parameter model(Kimura, 1980)에 의해 작성하였으며 1,000회의 bootstrap 분석을 통해 신뢰도를 평가하였다.
성능/효과
CB3 균주는 NA 배지 상에서 undulant round한 cream 색의 colony를 띄는 그람 양성의 간균으로 확인되었으며, 49가지 탄수화물의 발효 여부를 통하여 Bacillus속을 동정하는 API 50 CHB kit을 이용하여 분석한 결과 유용 길항미생물제제의 소재로 가장 널리 사용되고 있는 Bacillus속과 유사한 특성이 확인되었다(Table 1).
amyloliquefaciens로부터 항균기작 조사 시 균사체의 이상팽윤 증상과 이상비대 증식, 용균 현상을 확인한 바 있다. CB3 균주에 의해서도 P. digitatum을 포함하여 공시한 대부분의 병원균에서 비정상적인 균사형태를보였고 균사의 팽윤 현상과 용균 현상도 나타내어 기존 보고와 유사한 항균기작이 확인되었는데(data not shown), 특히 용균 현상에 의한 비정상적인 생장이 강하게 나타났다. 일반적으로 길항세균에 의해 저해되는 식물 병원균은 균사의 팽윤, 용균, 비대증식, 세포벽 분해, 세포막 분해 등의 현상으로 인해 정상적인 생장이 억제되는데 길항세균 CB3에서도 이러한 항균기작들이 고루 나타났다.
고농도의 감귤 녹색곰팡이병 병원균을 접종한 후 평가되었음에도 불구하고 처리 결과 배양여액에서 55.6%, 1 × 108 cfu/ml 처리에서 66.7%의 매우 실용적인 방제가가 나타났다(Table 2).
digitatum과 대치배양시켜 길항작용에 의한 저지원 형성을 확인하여 1차 선발하였다. 그 결과 21개의 내생균 중 7개의 균주가 clear zone을 형성하였다. 그 중 주요 감귤 저장병 병원균 P.
대표적인 감귤 녹색곰팡이병(Penicillium digitatum) 방제용 생물농약을 개발하고자 제주도내 7개 과수원으로부터 채집된 citrus 잎에서 21균주의 내생세균을 분리하였다. 그 중 5개의 세균이 녹색곰팡이병균 P. digitatum에 항균활성을 나타냈으며, 대치배양에서 가장 강력한 항균활성을 보인 CB3 균주가 선발되었다. CB3 균주는 간상형의 그람 양성세균으로 생리·생화학적 특성과 gyrA 유전자 염기서열 분석에 의해 Bacillus velezensis로 동정되었다.
2). 대치배양을 통해 CB3 균주에 의해 생육이 억제된 P. digitatum의 균사 선단부를 현미경으로 관찰했을 때, 비정상적인 균사의 모습이 관찰되었다 (Fig. 3). Lee(2010)는 CB3 균주와 유사한 관계에 있는 균주 B.
또한 정밀한 종동정을 위하여 분자생물학적 분석을 실시했을 때 16S rDNA 유전자 분석에서 Bacillus velezensis 와 99.7%의 유사도를 보였다(data not shown). 그러나 Bacillus subtilis complex 간의 16S rDNA 영역은 유사도가 매우 높으므로 더욱 정확한 균의 동정을 위해 gyrA 유전자의 염기서열 분석(Kim, 2005; Nam et al.
또한, 최적의 생장을 보인 molasses broth에서의 균 생육을 관찰한 결과, 산도가 높은 pH 4~5에서 거의 생육하지 못했으며 알카리성이 높아진 pH 9에서도 생육은 미약했다. 한편 pH 6~8의 중성 범위에서 균 생육이 활발하게 일어났으며, 특히 pH 6에서 가장 생육이 우수하였다.
선발된 5가지 배지에 대한 CB3 균주의 생육은 Nutrient broth에서는 24시간 배양 후에 균의 생육정도를 나타내는 OD 600값이 매우 낮은 수치를 기록하는데 반해 molasses broth상에서는 수치가 가장 높았는데, 특히 12~24시간 사이에 폭발적인 증가를 보여 효과적인 균 생육이 관찰되었다. Bacillus spp.
또한, 최적의 생장을 보인 molasses broth에서의 균 생육을 관찰한 결과, 산도가 높은 pH 4~5에서 거의 생육하지 못했으며 알카리성이 높아진 pH 9에서도 생육은 미약했다. 한편 pH 6~8의 중성 범위에서 균 생육이 활발하게 일어났으며, 특히 pH 6에서 가장 생육이 우수하였다. 실험 결과를 통해서 pH 6의 molasses broth를 CB3의 최적배양조건으로 결정하였다.
후속연구
digitatum에 대하여 강한 항균활성을 보이는 CB3 균주에 Bacillus속 균주의 장점을 살려 추후 보조제 추가와 같은 기능의 극대화를 모색하고 제형화, 제제화를 할 경우 매우 유용하게 식물병 방제제로서 사용이 가능할 것으로 사료된다. 그리고 현재 우리나라의 친환경 미생물농약의 합격 방제가 기준이 50%에 불과한 점을 고려하여 볼 때 본 실험 결과 얻어진 높은 방제가는 농업현장에 활용되었을 때 기대 이상의 큰 방제효과를 거둘 수 있을 것으로 판단되며 미생물농약으로서 높은 개발 가능성이 기대된다. 저항성 균주의 발생, 잔류농약 등의 합성 화학농약으로 인한 문제점 제기와 전 세계적으로 환경에 대한 소비자의 인식 증가로 합성 화학농약과 상반되는 개념을 가진 생물농약이 각광 받는 현실에서 소비자의 요구와 안전성을 만족시킬 수 있는 강력한 생물농약의 연구 개발이 필수적인 현실이다.
, 2009). 따라서 P. digitatum에 대하여 강한 항균활성을 보이는 CB3 균주에 Bacillus속 균주의 장점을 살려 추후 보조제 추가와 같은 기능의 극대화를 모색하고 제형화, 제제화를 할 경우 매우 유용하게 식물병 방제제로서 사용이 가능할 것으로 사료된다. 그리고 현재 우리나라의 친환경 미생물농약의 합격 방제가 기준이 50%에 불과한 점을 고려하여 볼 때 본 실험 결과 얻어진 높은 방제가는 농업현장에 활용되었을 때 기대 이상의 큰 방제효과를 거둘 수 있을 것으로 판단되며 미생물농약으로서 높은 개발 가능성이 기대된다.
저항성 균주의 발생, 잔류농약 등의 합성 화학농약으로 인한 문제점 제기와 전 세계적으로 환경에 대한 소비자의 인식 증가로 합성 화학농약과 상반되는 개념을 가진 생물농약이 각광 받는 현실에서 소비자의 요구와 안전성을 만족시킬 수 있는 강력한 생물농약의 연구 개발이 필수적인 현실이다. 따라서 본 연구에서 보고된 길항내생세균을 생물농약으로서 매우 유용하게 활용할 수 있을 것으로 생각된다.
7%로 매우 높았다. 본 연구결과, Bacillus velezensis CB3의 안정성과 강한 방제활성 등을 고려할 때 유용 친환경적 방제제로서 매우 가치가 있을 것으로 판단된다.
질의응답
핵심어
질문
논문에서 추출한 답변
감귤에 심각한 손실을 입히는 citrus의 대표적인 저장병 병원균과 병은 어떤 것이 있는가?
감귤류를 포함하는 citrus의 국내 주생산지인 제주도 뿐만 아니라 전세계적으로 citrus의 대표적인 저장병 병원균 P. digitatum에 의한 녹색곰팡이병과 P. italicum에 의한 푸른곰팡이병에 의한 감귤의 손실은 실로 심각하다(Sharma et al., 2009; Yu et al.
감귤 녹색곰팡이병을 방제하기 위해 오랫동안 권장되어 널리 사용된 방법은 무엇인가?
초기에는 전세계적으로 citrus과실 수확 후 감귤 녹색곰팡이병을 방제하기 위하여 합성 화합농약의 사용이 오랫 동안 감귤의 저장병 방제를 위한 최선의 방법으로 권장되어 널리 사용되었다(Smilanick et al., 2006; Ismail and Zhang, 2004).
본 연구에서 Bacillus velezensis CB3가 유용 친환경적 방제제로서 가치가 있을 것이라 생각되는 실험적 근거는 무엇인가?
CB3 균주는 간상형의 그람 양성세균으로 생리·생화학적 특성과 gyrA 유전자 염기서열 분석에 의해 Bacillus velezensis로 동정되었다. CB3 균주는 감귤 저장병 병원균 Penicillium digitatum에 강력한 항균활성을 나타내었다. 1 × 105 spores/ml에 이르는 고농도의 P. digitatum을 감귤에 상처접종했을 때에도, 1 × 108 cfu/ml의 CB3에 의한 방제효과는 66.7%로 매우 높았다. 본 연구결과, Bacillus velezensis CB3의 안정성과 강한 방제활성 등을 고려할 때 유용 친환경적 방제제로서 매우 가치가 있을 것으로 판단된다.
참고문헌 (26)
Alvindia, D. G. and Natsuaki, K. T. 2009. Biocontrol activities of Bacillus amyloliquefaciens DGA14 isolated from banana fruit surface against banana crown rot causing pathogens. Crop Protection 28:236-242.
Bus, V. G., Bongers, A. J. and Risse, L. A. 1991. Occurrence of Penicillium digitatum and P. italicum resistant to benomyl, thiabendazole, and imazalilon citrus fruit from different geographic origins. Plant Dis. 75:1098-1100.
Chun, J. 1995. Computer-assisted classification and identification of actinomycetes. Ph. D. Thesis, University of Newcastle upon Tyne, UK.
Chun, J. S. and Bae, K. S. 2000. Phylogenetic analysis of Bacillus subtilis and related taxa based on partial gyrA gene sequences. Antonievan Leeuwenhoek 78:123-127.
Harding, P. R. 1972. Differential sensitivity to thiabendazole by strains of Penicillium italicum and P. digitatum. Plant Dis. Rep. 56:256-260.
Ismail, M. and Zhang, J. 2004. Post-harvest citrus diseases and their control outlooks. Pest Manage 15:29-35.
Kim, G. H., Oh, S. O., Hur, J. S., Yum, K. J. and Koh, Y. J. 2006. Optimum cultivation conditions for mass production of an antagonistic bacterium Bacillus subtilis BD0310 for Development of a Microbial Agent Controlling Gray Blight of Tea Plants. Res. Plant Dis. 12:85-90.
Kim, H. W., Lee, K. Y., Baek, J. W., Kim, H. J., Park, J. Y., Lee, J. W., Jung, S. J. and Moon, B, J. 2004. Isolation and identification of antagonistic bacterium active against Sclerotinia sclerotioum causing Sclerotinia rot on crisphead lettuce. Res. Plant Dis. 10:331-336.
Kim, J. H. Choi, Y. H., Kang, S. J., Joo, G. J., Suh, J. S. and Lim, T. H. 2003. Isolation of Bacillus amyloliquefaciens MJ-3 and its effect on the early growth promotion of red pepper plug seedlings in compost. Korean Journal of Life Science 13:582-589.
Kim, Y. S. 2005. Biocontrol activity of antifungal antibiotics producing Bacillus atrophaeus CNU05-1 against Botrytis gray mold. Graduate School of Chungnam National University.
Kimura, M. 1980. A simple method for estimating evolutionary rate of base substitution through comparative studies of nucleotide sequence. J. Mol. Evol. 16:111-120.
Kinay, P., Mansour, M. F., Gabler, F. M., Margosan, D. A. and Smilanick, J. L. 2007. Characterization of fungicide-resistant isolates of Penicillium digitatum collected in California. Crop Protection 26:647-656.
Kong, H. G. Chun, O. J., Choi, K. H., Lee, K. Y., Baek, J. W., Kim, H. J., Murugaiyan, S., Moon, B. J., and Lee, S. W. 2010. Formulation of Bacillus amyloliquefaciens A-2 and its efficacy to control tomato leaf mold caused by Fulvia fulva. Res. Plant Dis. 16:27-34
Lee, D. G. 2010. Biological control of strawberry anthracnose using endophytic bacteria, Bacillus amyloliquefaciens CP1. Graduate School of Chungnam National University.
Lee, J. B., Shin, J. H., Jang, J. O., Shin, K. S., Choi, C. S., Kim, K. W., Jo, M. S., Jeon, C. P., Kim, Y. H. and Kwon, G. S. 2008. Antifungal activity of Bacillus sp. AM-651 against Phytophthora capsici. Kor. J. Microbiol. Biotechnol. 36:227-232.
Maldonado M. C., Corona J., Gordillo M. A. and Navarro A. R. 2009. Isolation and partial characterization of antifungal metabolites produced by Bacillus sp. IBA33. Curr. Microbiol. 59:646-650.
Nam, M. H., Park, M. S., Kim, H. G. and Yoo, S. J. 2009. Biological control of strawberry fusarium wilt caused by Fusarium oxysporum f. sp. fragariae using Bacillus velezensis BS87 and RK1 formulation. J. Microbiol. Biotechnol. 19:520-524.
Roh J. Y., Liu Q., Choi J. Y., Wang Y., Shim H. J., Xu H. G., Choi G. J., Kim J. C. and Je Y. H. 2009. Construction of a recombinant Bacillus velezensis strain as an integrated control agent against plant diseases and insect pests. J. Microbiol. Biotechnol. 19:1223-1229.
Romero, D., de Vicente, A., Rakotoaly, R. H., Dufour, S. E., Veening, J. W., Arrebola, E., Cazorla, F. M., Kuiper, O. P., Paquot, M. and Perez-Garcia, A. 2007. The iturin and fengycin families of lipopeptides are key factors in antagonism of Bacillus subtilis towards Podosphaera fusca. Mol. Plant Microbe. Interact. 20:430-440.
Sharma, R. R., Sing, H. D. and Sing, H. R. 2009. Biological control of postharvest diseases of fruits and vegetables by microbial antagonist. Biological Control 50:205-221.
Smilanick, J. L., Brown, G. E. and Eckert, J. W. 2006. Postharvest citrus diseases and their control. Fresh Citrus Fruits, 2nd Ed. Science Source 339-396.
Wang L. T., Lee F. L., Tai C. J. and Kuo H. P. 2008. Bacillus velezensis is a later heterotypic synonym of Bacillus amyloliquefaciens. Int. J. Syst. Evol. Microbiol. 58:671-5.
Yu, G. Y., Sinclair, J. B., Hartman, G. L. and Bertagnolli, B. L. 2002. Production of iturin A by Bacillus amyloliquefaciens suppressing Rhizoctonia solani. Soil Biol Biochem. 34:955-963.
Yu, S. M., Kim, Y. K., Nam, H. S., Lee, Y. K., Lee, S. D., Lee, K. J. and Lee, Y. H. 2010. Suppression of green and blue mold in postharvest mandarin fruit by treatment of Pantoea agglomerans 59-4. Plant Pathol. J. 26:353-359.
※ AI-Helper는 부적절한 답변을 할 수 있습니다.