[논문]밀 고분자 글루테닌 유전자를 이용하여 빵 가공적성 증진을 위한 마커 프리 형질전환 벼의 개발

박수권; 신동진; 황운하; 오세윤; 조준현; 한상익; 남민희; 박동수

doi:10.5352/jls.2013.23.11.1317

밀 고분자 글루테닌 유전자를 이용하여 빵 가공적성 증진을 위한 마커 프리 형질전환 벼의 개발
Development of Marker-free Transgenic Rice for Increasing Bread-making Quality using Wheat High Molecular Weight Glutenin Subunits (HMW-GS) Gene 원문보기

생명과학회지 = Journal of life science, v.23 no.11 = no.163, 2013년, pp.1317 - 1324

초록
AI-Helper

고분자 글루테닌 서버유닛(high molecular-weight glutenin subunit, HMW-GS)은 밀의 가공적성을 결정하는데 중요한 역할을 수행한다. 우리는 Agrobacterium 동시 형질전환법을 이용하여 한국 밀 품종인 '조경'으로부터 밀 HMW-GS을 암호화하는 Glu-1Bx7 유전자를 가지는 marker-free 형질전환 벼를 생산하였다. Glu-1Bx7 유전자의 종자 특이적 발현을 위하여 밀 Glu-1Bx7 유전자 자체 프로모터를 벡터 내에 삽입하였다. 동시 접종을 위해서 오직 Glu-1Bx7 유전자와 hygromycin phosphotransferase II (HPTII) 저항성 유전자만으로 구성된 두 종류의 발현 카셋트를 독립적으로 Agrobacterium EHA105에 도입하였고, Glu-1Bx7와 HPTII가 도입된 각각의 EHA105 Agrobacterium 을 3:1 비율로 혼합하여 벼 캘러스에 접종하였다. 216개의 HPTII 저항성 형질전환체 중에서 벼 게놈에 Glu-1Bx7과 HPTII가 모두 삽입된 24개의 형질전환 라인을 획득하였다. Glu-1Bx7와 HPTII가 벼 게놈에 도입된 것을 Southern blot을 통해서 다시 확인하였다. 형질전환 벼 $T_1$ 세대의 종자에서 밀 Glu-1Bx7 유전자가 전사와 번역되어 오직 Glu-1Bx7만을 가지는 marker-free 식물체를 $T_1$ 세대에서 성공적으로 선발할 수 있었다.

Abstract ▼ AI-Helper

High-molecular weight glutenin subunits (HMW-GS) have been shown to play a crucial role in determining the processing properties of the wheat grain. We have produced marker-free transgenic rice plants containing a wheat Glu-1Bx7 gene encoding the HMG-GS from the Korean wheat cultivar 'Jokyeong' using the Agrobacterium-mediated co-transformation method. The Glu-1Bx7-own promoter was inserted into a binary vector for seed-specific expression of the Glu-1Bx7 gene. Two expression cassettes comprised of separate DNA fragments containing only Glu-1Bx7 and hygromycin phosphotransferase II (HPTII) resistance genes were introduced separately to the Agrobacterium tumefaciens EHA105 strain for co-infection. Each EHA105 strain harboring Glu-1Bx7 or HPTII was infected to rice calli at a 3:1 ratio of Glu-1Bx7 and HPTII, respectively. Then, among 216 hygromycin-resistant $T_0$ plants, we obtained 24 transgenic lines with both Glu-1Bx7 and HPTII genes inserted into the rice genome. We reconfirmed integration of the Glu-1Bx7 gene into the rice genome by Southern blot analysis. Transcripts and proteins of the wheat Glu-1Bx7 were stably expressed in the rice $T_1$ seeds. Finally, the marker-free plants harboring only the Glu-1Bx7 gene were successfully screened at the $T_1$ generation.

주제어

AI 본문요약
AI-Helper

* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.

제안 방법

tumefaciens EHA105 strain for plant transformation. Each binary vector was rescued from the EHA105 strain harboring Glu-1Bx7 and the HPTII, and the HPTII and Glu-1Bx7 genes were validated by PCR analysis.
Genomic DNA from 216 independent T₀ plants was extracted and insertion of HPTII and Glu-1Bx7 genes was analyzed using PCR analysis with gene specific primers. As shown in Fig.
Identification of T₀ plants by gene specific primer sets. Glu-1Bx7 (upper panel) and HPTII (lower panel) genes were amplified using Glu-1Bx7 and HPTII specific primer sets, respectively. SM, molecular marker; ‘Dongjin’ (Korean rice cultivar), non-transgenic plant; Jokyeong, Korean wheat cultivar; Plasmid, vector construct containing Glu-1Bx7 and HPTII genes; 1-22, co-transformant transgenic lines.
In this study, we cloned Glu-1Bx7, which is one of HMW-GS genes, and validated the insertion of the Glu-1Bx7 gene in T0 plants through PCR analysis with gene specific primers and Southern blot analysis (Fig. 2, 3). The Glu1Bx7-own promoter was introduced for seed specific expression of Glu-1Bx7 gene.
PCR was performed with the GeneAmp System 9700 (Applied Biosystems, Foster City, CA, USA) with a gene-specific primer set (Glu-1Bx7; forward 5'- AGGGTACCGAGATGGCTAAGCGCCTGG -3', reverse 5'- GATCTAGATCACTGCCTGGTCGACAATG -3', HPTII; forward 5'- CGCTTCTGCGGGCGATTT -3', reverse 5'- CCCATTCGGACCGCAAGGA -3') and EF Taq DNA polymerase (Solgent Co. Seoul, South Korea).

이론/모형

In this study, we generated marker-free transgenic rice expressing the wheat HMW-GS protein without any herbicide or antibiotic resistance marker genes using the co-transformation method. The marker-free transgenic plant expressing Glu-1Bx7 gene is critical material for generating transgenic plant advanced quality processing of bread and noodle without antibiotic markers.

참고문헌 (32)

Altpeter, F., Vasil, V., Srivastava, V. and Vasil, I. K. 1996. Integration and expression of the high-molecular-weight glutenin subunit 1Ax1 gene into wheat. Nat Biotechnol 14, 1155-1159.

상세보기
Alvarez, M. L., Guelman, S., Halford, N. G., Lusting, S., Reggiardo, M. I., Ryabushkina, N., Shewry, P., Stein, J. and Vallejos, R. H. 2000. Silencing of HMW glutenins in transgenic wheat expressing extra HMW subunits. Theor Appl Genet 100, 319-327.

상세보기
An, G., Evert, P. R., Mitra, A. and Ha, S. B. 1988. Binary vectors. pp. A3/1-19, In: Gelvin, S. B. and. Schilperoort, R. A. (eds.), Plant molecular biology manual. Kluwer Academic Publishers, Boston, MA.
Araki, E., Ikeda, M. T., Ohgihara, Y., Toyoda, A. and Yano, H. 2008. Development of transgenic rice (Oryza sativa L.) expressing wheat high- and low-molecular-weight glutenin subunit proteins. Breed Sci 58, 121-128.

상세보기
Barro, F., Rooke, L., Bekes, F., Gras, P., Tatham, A. S., Fido, R., Lazzeri, P. A., Shewry, P. R. and Barcelo, P. 1997. Transformation of wheat with high-molecular-weight subunit genes results in improved functional properties. Nat Biotechnol 15, 1295-1299.

상세보기
Blechl, A. E. and Anderson, O. D. 1996. Expression of a novel highmolecular-weight glutenin gene in transgenic wheat. Nat Biotechnol 14, 875-879.

상세보기
Chen, H., Nelson, R. S. and Sherwood, J. L. 1994. Enhanced recovery of transformants of Agrobacterium tumefaciens after freeze-thaw transformation and drug selection. Biotechniques 16, 664-669.

상세보기
Cho, J. I., Ryoo, N., Ko, S., Lee, S. K., Lee, J., Jung, K. H., Lee, Y. H., Bhoo, S. H., Winderickx, J., An, G., Hahn, T. R. and Jeon, J. S. 2006. Structure, expression, and functional analysis of the hexokinase gene family in rice (Oryza sativa L.). Planta 224, 598-611.

상세보기
Chu, C. C., Wang, C. S., Sun, C. S., Hsu, C., Yin, K. C., Chu, C. Y. and Yun, B. F. 1975. Establishment of an efficient medium for anther culture of rice through comparative experiments on the nitrogen sources. Sci China Math 18, 659-668.
Galili, G. 1989. Heterologous expression of a wheat highmolecular-weight glutenin gene in Escherichia coli. Proc Natl Acad Sci USA 86, 7756-7760.

상세보기
Hiei, Y., Ohta, S. Komari, T. and Kumashiro, T. 1994. Efficient transformation of rice (Oryza sativa L.) mediated by agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 6, 271-282.

상세보기
Hohn, B., Levy, A. A. and Puchta, H. 2001. Elimination of selection markers from transgenic plants. Curr Opin Biotechnol 12, 139-143.

상세보기
Komari, T., Hiei, Y., Saito, Y., Murai, N. and Kumashiro, T. 1996. Vectors carrying two separate T-DNAs for co-transformation of higher plants mediated by Agrobacterium tumefaciens and segregation of transformants free from selection markers. Plant J 10, 165-174.

상세보기
Kuiper, H. A., Kleter, G. A., Noteborn, H. P. and Kok, E. J. 2001. Assessment of the food safety issues related to genetically modified foods. Plant J 27, 503-528.

상세보기
Kumpatla, S. P., Chandrasekharan, M. B., Iyer, L. M., Li, G. and Hall, T. C. 1998. Genome intruder scanning and modulation systems and transgene silencing. Trends Plant Sci 3, 97-104.

상세보기
Matzke, M. A., Matzke, J. M. and Eggleston, W. B. 1996. Paramutation and transgene silencing: a common response to invasive DNA? Trends Plant Sci 1, 382-388.

상세보기
McElroy, D., Zhang, W., Cao, J. and Wu, R. 1990. Isolation of an efficient actin promoter for use in rice transformation. Plant Cell 2, 163-171.

상세보기
Park, S. K., Jung, Y. J., Lee, J. R., Lee, Y. M., Jang, H. H., Lee, S. S., Park, J. H., Kim, S. Y., Moon, J. C., Lee, S. Y., Chae, H. B., Shin, M. R., Jung, J. H., Kim, M. K., Kim, Y. Y., Yun, D. J., Lee, G. O. and Lee, S. Y. 2009. Heat-shock and redox-dependent functional switching of an h-type arabidopsis thioredoxin from a disulfide reductase to a molecular chaperone. Plant Physiol 150, 552-561.

상세보기
Payne, P. I., Corfield, K. G. and Blackman, J. A. 1979. Identification of a high-molecular-weight subunit of glutenin whose presence correlates with breadmaking quality in wheats of related pedigree. Theor Appl Genet 55, 153-159.

상세보기
Payne, P. I., Corfield, K. G., Holt, L. M. and Blackman, J. A. 1981. Correlations between the inheritance of certain high-molecular-weight subunits of glutenin and breadmaking quality in progenies of six crosses of bread wheat. J Sci Food Agric 32, 51-60.

상세보기
Payne, P. I., Law, C. N. and Mudd, E. E. 1980. Control by homologous group 1 chromosomes of the high-molecular- weight subunits of glutenin, a major protein of wheat endosperm. Theor Appl Genet 58, 113-120.
Payne, P. I., Nightingale, M. A., Krattiger, A. F. and Holt, L. M. 1987. The relationship between HMW glutenin subunit composition and the bread-making quality of Britishgrown wheat varieties. J Sci Food Agric 40, 51-65.

상세보기
Roberts, L. S., Thompson, R. D. and Flavell, R. B. 1989. Tissue-specific expression of a wheat high-molecular-weight glutenin gene in transgenic tobacco. Plant Cell 1, 569-578.

상세보기
Rooke, L., Barro, F., Tatham, A. S., Fido, R., Steele, S., Bekes, F., Gras, P., Martin, A., Lazzeri, P. A., Shewry, P. R. and Barcelo, P. 1999. Altered functional properties of tritordeum by transformation with HMW glutenin subunit genes. Theor Appl Genet 99, 851-858.

상세보기
Ramessar, K., Peremarti, A., Gomez-Galera, S., Naqvi, S., Moralejo, M., Munoz, P., Capell, T. and Christou, P. 2007. Biosafety and risk assessment framework for selectable marker genes in transgenic crop plants: a case of the science not supporting the politics. Transgenic Res 16, 261-280.

상세보기
Shewry, P. R., Halford, N. G. and Tatham, A. S. 1989. The high-molecularweight subunits of wheat, barley and rye: genetics, molecular biology, chemistry and role in wheat gluten structure and functionality. Oxford Surveys Plant Mol Cell Biol l6, 163-219.
Shewry, P. R., Tatham, A. S., Fido, R., Jones, H., Barcelo, P. and Lazzeri, P. A. 2001. Improving the end use properties of wheat by manipulating the grain protein composition. Euphytica 119, 45-48.

상세보기
Tatham, A. S. and Shewry, P. R. 1985. The conformation of wheat gluten proteins. The secondary structures and thermal stabilities of alpha-, beta-, gamma- and omega- gliadins. J Cereal Sci 3, 103-113.

상세보기
Thompson, B. G., Anderson, R. and Murray, R. G. 1980. Unusual polar lipids of Micrococcus radiodurans strain Sark. Can J Microbiol 26, 1408-1411.

상세보기
Vaucheret, H., Beclin, C., Elmayan, T., Feuerbach, F., Godon, C., Morel, J.-B., Mourrain, P., Palauqui, J. C. and Vernhettes, S. 1998. Transgene-induced gene silencing in plants. Plant J 16, 651-659.

상세보기
Volkov, R. A., Panchuk, I. I. and SchoZ, F. 2003. Heatstress-dependency and developmental modulation of gene expression: the potential of house-keeping genes as internal standards in mRNA expression profiling using real-time RT-PCR. J Exp Bot 54, 2343-2349.

상세보기
Zhiwu, Li. and Harold, N. T. 2005. Rapid method for high-quality RNA isolation from seed endosperm containing high levels of starch. Biotechniques 38, 872-876.

상세보기

저자의 다른 논문 :

LOADING...

표제어: PCR

동의어: Packet Collision Rate

용어 설명 출처 목록 (6)

용어 설명: PCR은 세균 특이성이 있는 primer를 이용하여 적은 수의 세균이 있을지라도 쉽게 검출할 수 있는 유용한 방법이며, 이를 이용하여 구강 내 치면세균막이나 타액에서 직접 세균을 검출할 수 있게 되었다[8].

내보내기 구분	파일저장 인쇄 메일전송
구성항목	기본정보 상세정보 관리번호, 논문명, 저널/프로시딩명, 저자 , 발행년, 권, 호, 시작페이지, 끝페이지, 발행기관 관리번호, 논문명, 대등논문명, 저자 , 저널/프로시딩명, 발행기관, 발행년, 발행언어, 권, 호, 시작페이지, 끝페이지, ISBN, ISSN, 주제분야, 키워드, 초록(한글), 초록(영문), 저자(소속기관)
저장형식	Text(ASCII format) Excel format RefWorks Direct Export RIS format (for Reference Manager, ProCite, EndNote), Scholar's Aids, Mendeley
메일정보	받는사람 (필수) @ 보내는사람 (선택) @ 제목 내용 KISTI 검색결과 이메일 서비스
안내	총 건의 자료가 검색되었습니다. 다운받으실 자료의 인덱스를 입력하세요. (1-10,000) 검색결과의 순서대로 최대 10,000건 까지 다운로드가 가능합니다. 데이타가 많을 경우 속도가 느려질 수 있습니다.(최대 2~3분 소요) 다운로드 파일은 UTF-8 형태로 저장됩니다. 파일의 내용이 제대로 보이지 않을실 때는 웹브라우저 상단의 보기 -> 인코딩 -> 자동선택 여부를 확인하십시오. ~ Text(ASCII format) Excel format

연합인증