Kwon, Anam
(Animal Genomics and Bioinformatics Division, National Institute of Animal Science)
,
Srikanth, Krishnamoorthy
(Animal Genomics and Bioinformatics Division, National Institute of Animal Science)
,
Lee, Eunjin
(Animal Genomics and Bioinformatics Division, National Institute of Animal Science)
,
Kim, Seonkwan
(Animal Genomics and Bioinformatics Division, National Institute of Animal Science)
,
Chung, Hoyoung
(Animal Genomics and Bioinformatics Division, National Institute of Animal Science)
Background: Our previous study had identified the SNP (g.81966377T > C) and indel (g.81966364D > I) located in the promoter of APM1 to have a significant effect on marbling in Hanwoo. APM1 encodes an adipocytokine called adiponectin, which plays a significant role in lipogenesis. The aim of this stu...
Background: Our previous study had identified the SNP (g.81966377T > C) and indel (g.81966364D > I) located in the promoter of APM1 to have a significant effect on marbling in Hanwoo. APM1 encodes an adipocytokine called adiponectin, which plays a significant role in lipogenesis. The aim of this study was to verify and validate the effect of the SNP and indel on marbling and other carcass traits in a large, representative, countrywide population of Hanwoo cattle. The carcass traits measured were marbling (MAR), backfat thickness (BFT), loin eye area (LEA), and carcass weight (CAW). Results: Primers were designed to amplify 346 bp of the genomic segment that contained the targeted SNP (g.81966377) and the indel (g.81966364). After data curation, the genotypes of 8,378 individuals identified using direct sequencing analysis estimated frequencies for C (0.686) and T (0.314) respectively showing genotype frequencies for CC (0.470), CT (0.430) and TT (0.098). The genotypes were significantly associated with MAR, BFT and LEA. The indel had significant effect on marbling (P < .0001) with strong additive genetic effects. The allele frequencies was estimated at (DEL, 0.864) and insertion (INS, 0.136) presenting genotypes of D/D (75.63 %), D/I (21.44 %), and I/I (2.92 %). Significant departure from Hardy-Weinberg equilibrium was not detected for both the SNP and the indel. Conclusion: The SNP genotypes showed significant association with MAR, BFT and LEA with strong additive genetic effects, while the indel was significantly associated with MAR. The results confirmed that the variants can be used as a genetic marker for improving marbling in Hanwoo.
Background: Our previous study had identified the SNP (g.81966377T > C) and indel (g.81966364D > I) located in the promoter of APM1 to have a significant effect on marbling in Hanwoo. APM1 encodes an adipocytokine called adiponectin, which plays a significant role in lipogenesis. The aim of this study was to verify and validate the effect of the SNP and indel on marbling and other carcass traits in a large, representative, countrywide population of Hanwoo cattle. The carcass traits measured were marbling (MAR), backfat thickness (BFT), loin eye area (LEA), and carcass weight (CAW). Results: Primers were designed to amplify 346 bp of the genomic segment that contained the targeted SNP (g.81966377) and the indel (g.81966364). After data curation, the genotypes of 8,378 individuals identified using direct sequencing analysis estimated frequencies for C (0.686) and T (0.314) respectively showing genotype frequencies for CC (0.470), CT (0.430) and TT (0.098). The genotypes were significantly associated with MAR, BFT and LEA. The indel had significant effect on marbling (P < .0001) with strong additive genetic effects. The allele frequencies was estimated at (DEL, 0.864) and insertion (INS, 0.136) presenting genotypes of D/D (75.63 %), D/I (21.44 %), and I/I (2.92 %). Significant departure from Hardy-Weinberg equilibrium was not detected for both the SNP and the indel. Conclusion: The SNP genotypes showed significant association with MAR, BFT and LEA with strong additive genetic effects, while the indel was significantly associated with MAR. The results confirmed that the variants can be used as a genetic marker for improving marbling in Hanwoo.
* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.
문제 정의
The aim of this study was to verify the genetic effect of the SNP g.81966377T > C and an indel (g.81966364D > I) located in the promoter of AMP1 on carcass traits in a nationwide randomly sampled Hanwoo cattle.
제안 방법
The bovine APM1 gene sequence (GenBank: JQ7755868) was retrieved from the Genbank database to design PCR primers using DNA select program of the DNAstar package (Version 6.0). The forward and reverse sequences are CAGCTCGGTACTCATGGGGACAAG and GTGGGAG CTGATGGTGGTAACTGG, respectively.
대상 데이터
The samples were collected over a period of 3 years from 2013 to 2015. The data collected were (MAR, ranging from 1 (for poor) to 9 (highest quality)), loin eye area (LEA, cm2) and backfat thickness (BFT, cm). The average slaughter age of the animals was 31.
The primers were designed to amplify a 346 bp of the APM1 promoter region which included the targeted SNP (g.81966377T > C) and indel (g.81966364D > I) that was previously identified [2, 6, 8, 12].
The samples were collected from the longissimus thoracis muscle between the 12th and 13th rib and stored immediately at -70 °C until use.
The samples were collected from the longissimus thoracis muscle between the 12th and 13th rib and stored immediately at -70 °C until use. The samples were collected over a period of 3 years from 2013 to 2015. The data collected were (MAR, ranging from 1 (for poor) to 9 (highest quality)), loin eye area (LEA, cm2) and backfat thickness (BFT, cm).
데이터처리
The statistical analyses were performed using the Statistical Analysis System [14]. Analysis of Variance (ANOVA) based on general linear model (GLM) was performed to check the genotype effects on carcass traits. The statistical model used was as follows,
이론/모형
The statistical analyses were performed using the Statistical Analysis System [14]. Analysis of Variance (ANOVA) based on general linear model (GLM) was performed to check the genotype effects on carcass traits.
성능/효과
The genotypes of the indel was strongly associated with MAR (P < 0.0001) with significant additive effect, while no significant association with BFT, LEA and CAW was detected (Table 2).
However in order for using this SNP as a standardized genetic marker the effect of this variant on carcass traits has to be verified and validated on a large sample set that is representative of the entire Hanwoo population. Unlike our previous study which had used samples from a specific region, in this study samples were collected from KAPE located throughout the country, in all 8,378 samples were genotyped and their association with meat quality traits were analyzed. Significant additive effects were identified for MAR, BFT and LEA.
참고문헌 (19)
1. Berg AH Combs TP Scherer PE ACRP30/adiponectin: an adipokine regulating glucose and lipid metabolism Trends Endocrinol Metab 2002 13 2 84 9 10.1016/S1043-2760(01)00524-0 11854024
2. Morsci NS Schnabel RD Taylor JF Association analysis of adiponectin and somatostatin polymorphisms on BTA1 with growth and carcass traits in Angus cattle Anim Genet 2006 37 6 554 62 10.1111/j.1365-2052.2006.01528.x 17121600
3. Piñeiro R Iglesias MJ Gallego R Raghay K Eiras S Rubio J Adiponectin is synthesized and secreted by human and murine cardiomyocytes FEBS Lett 2005 579 23 5163 9 10.1016/j.febslet.2005.07.098 16140297
4. Scherer PE Williams S Fogliano M Baldini G Lodish HF A novel serum protein similar to C1q, produced exclusively in adipocytes J Biol Chem 1995 270 45 26746 9 10.1074/jbc.270.45.26746 7592907
5. Yokota T Paracrine regulation of fat cell formation in bone marrow cultures via adiponectin and prostaglandins J Clin Invest 2002 109 10 1303 10 10.1172/JCI0214506 12021245
6. Choi Y Davis ME Chung H Effects of genetic variants in the promoter region of the bovine adiponectin (ADIPOQ) gene on marbling of Hanwoo beef cattle Meat Sci 2015 105 57 62 10.1016/j.meatsci.2015.02.014 25817801
7. Lee SH Kim UH Dang CG Aditi S Kim HC Yeon SH Strategies to multiply elite cow in Hanwoo small farm J Embryo Transf 2013 28 2 79 85 10.12750/JET.2013.28.2.79
8. Shin S Chung E Novel SNPs in the bovine ADIPOQ and PPARGC1A genes are associated with carcass traits in Hanwoo (Korean cattle) Mol Biol Rep 2013 40 7 4651 60 10.1007/s11033-013-2560-0 23649766
9. Wu X Cooper RS Borecki I Hanis C Bray M Lewis CE A combined analysis of genomewide linkage scans for body mass index from the National Heart, Lung, and Blood Institute Family Blood Pressure Program Am J Hum Genet 2002 70 5 1247 56 10.1086/340362 11923912
10. Fox CS, Heard-Costa N, Cupples LA, Dupuis J, Vasan RS, Atwood LD. Genome-wide association to body mass index and waist circumference: the Framingham Heart Study 100 K project. BMC Med Genet. 2007;8 Suppl 1:S18.
11. Biver E Salliot C Combescure C Gossec L Hardouin P Legroux-Gerot I Influence of adipokines and ghrelin on bone mineral density and fracture risk: a systematic review and meta-analysis J Clin Endocrinol Metab 2011 96 9 2703 13 10.1210/jc.2011-0047 21778223
12. Zhang L Yang M Li C Xu Y Sun J Lei C Identification and genetic effect of a variable duplication in the promoter region of the cattle ADIPOQ gene Anim Genet 2014 45 2 171 9 10.1111/age.12112 24341634
13. Lee SH Park BH Sharma A Dang CG Lee SS Choi TJ Hanwoo cattle: origin, domestication, breeding strategies and genomic selection J Anim Sci Tech 2014 56 2 10.1186/2055-0391-56-2
16. Dall’Olio S Davoli R Buttazzoni L Zambonelli P Russo V Study of porcine adiponectin (ADIPOQ) gene and association of a missense mutation with EBVs for production and carcass traits in Italian Duroc heavy pigs Livest Sci 2009 125 1 101 4 10.1016/j.livsci.2009.03.003
17. Zhang L, Chen H, Lan X, Zhang C, Zhang L, Zhang A, et al. The novel 5 bp deletion polymorphism in the promoter region of bovine ACRP30 gene. Mol Biol Rep. 2009;36(5):895–9.
18. Berner HS Lyngstadaas SP Spahr A Monjo M Thommesen L Drevon CA Adiponectin and its receptors are expressed in bone-forming cells Bone 2004 35 4 842 9 10.1016/j.bone.2004.06.008 15454091
19. Oshima K Nampei A Matsuda M Iwaki M Fukuhara A Hashimoto J Adiponectin increases bone mass by suppressing osteoclast and activating osteoblast Biochem Biophys Res Commun 2005 331 2 520 6 10.1016/j.bbrc.2005.03.210 15850790
※ AI-Helper는 부적절한 답변을 할 수 있습니다.