최소 단어 이상 선택하여야 합니다.
최대 10 단어까지만 선택 가능합니다.
다음과 같은 기능을 한번의 로그인으로 사용 할 수 있습니다.
NTIS 바로가기韓國資源植物學會誌 = Korean journal of plant resources, v.30 no.5, 2017년, pp.522 - 534
류재혁 (한국원자력연구원 정읍첨단방사선연구소 방사선육종연구실) , 유재일 (기초과학연구원 식물노화수명연구단) , 배창휴 (순천대학교 대학원 식물생산과학부)
This study was investigated genetic variation in 24 Taraxacum accessions from various regions in South Korea based on the sequences of two chloroplast DNA (cpDNA) regions (trnL-trnF and rps16-trnK). T. mongolicum, T. officinale, and T. laevigatum were triploid, and T. coreanum and T. coreanum var. f...
핵심어 | 질문 | 논문에서 추출한 답변 |
---|---|---|
민들레란 무엇인가? | 민들레는 국화과(Compositae)에 속하는 다년생 초본 식물로 전초, 뿌리, 잎과 꽃 등 전체 부위를 약용 및 식용으로 사용할 수 있는 약용자원이다(Yun and Kim, 2010; Ryu, 2012). 한방에서는 민들레(T. | |
붉은씨서양민들레의 종특이적인 염기서열은 어떠한가? | 서양민들레의 종특이적인 염기서열 중 300에서 311번 사이에 서양민들레 종특이적인 염기서열 11개(GTAGACATAAT)를 연속하여 보유하였고, 이외 2개(285번; 티민, 684번 구아닌)의종특이적 염기가 검출되었다. 붉은씨서양민들레는 955번에서 1032번 사이에 77개 염기(CTGGCTCCTTCAGGAATTAGTTGGGATAGCTCAGTTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACCTGTTCAAAT)를 보유하였고, 이외에 12개(시토신: 893번, 894번, 910번, 927번, 티민: 906번, 934번, 946번, 구아닌:919번, 921번, 950번, 결손: 911번, 939번)의 염기를 특이적으로 보유하였다. trnL-trnF 영역의 털민들레, 흰민들레, 흰노랑민들레와 서양민들레, 붉은 씨 서양민들레 간 차이를 나타낸 염기서열은 41개가 검출되었다. | |
엽록체 DNA의 특징은 무엇인가? | 엽록체 DNA (chloroplast DNA)는 유전자의 배열, 구조 및 크기 등에 있어서 매우 보존적이며, 세포내에 많은 수가 존재하고 핵에 비하여 상대적으로 크기가 작아 실험이 용이하고, 여러 식물에서 엽록체 DNA의 전체 염기서열이 분석되어 비교연구가 가능하므로 엽록체 DNA의 염기서열 분석은 식물 계통 분류에 매우 유용하다(Boo and Park, 2016; Kim et al., 2016a). |
Fang, G., S. Hammar and R. Grumet. 1992. A quick inexpensive method of removing ploysaccharides from plant genomic DNA. Biotechniques 13:52-55.
Kim, J.K., J.Y. Park, Y.S. Lee, S.M. Woo, H.S. Park, S.C. Lee, J.H. Kang, T.J. Lee, S.H. Sung and T.J. Yang. 2016b. The complete chloroplast genomes of two Taraxacum species, T. platycarpum Dahlst. and T. mongolicum Hand.-Mazz. (Asteraceae). Mitochondrial DNA Part B. 1:412-413.
Kitamura, S. 1957. Compositae Japonicae. Mem. Coll. Sci. Univ. Kyoto ser. B, 24:1-42.
Korea National Arboretum. 2017. Nature www.nature.go.kr.
Lee, C.B. 1993. Illustrated flora of Korea. Hyangmoonsa Press, Seoul, Korea. pp. 783-784.
Lee, Y.N. 1996. Flora of Korea. Kyohak Press, Seoul, Korea. pp. 866-868 (in Korean).
Morita, T. 1976. Geographical distribution of diploid and polyploid Taraxacum in Japan. Bull. Natn. Sci. Mus. 2:23-38.
Martonfiova, L., L. Majesky and P. Martonfi. 2007. Polyploid progeny from cresses between diploid sexuals and tetraploid apomictic pollen donprs in Taraxacum Sect. Ruderalia. Acta Biol. Cracoviensia Ser. Bot. 49(1):47-54.
Ministry of Food and Drug Safety. 2011. The Korean Herbal Pharmacopeia. Korea Administration, Seoul, Korea.
Nakai, T. 1952. A synoptical sketch of Korean flora. Bul. Nat. Sci. Mus. 31:129-135.
Neuhaus, H. and G. Link. 1987. The chloroplast tRNALys (UUU) gene from mustard (Sinapsis alba) contains a class II intron potentially coding for a maturase-related polypeptide. Curr. Genet. 11:251-257.
Richards, A.J. 1973. The origin of Taraxacum agamospecies. Bot. J. Linn. Soc. 66:189-211.
Ryu, J.H. 2012. Growth and development characteristics and genetic diversity analysis of genus Taraxacum accessions collected in Korea. Department of Plant Sciences, Ph.D. Thesis, Sunchon Nat'l Univ., Korea.
Shibaike, H., H. Akiyama, S. Uchiyama, K. Kasai and T. Morita. 2002. Hybridization between European and Asian dandelions (Taraxacum section Ruderalia and section Mongolica). 2. Natural hybrids in Japan detected by chloroplast DNA marker. J. Plant Res. 115:321-328.
Salih, R.H.M., L. Majesky, T. Schwarzacher, R. Gornall and P. Heslop-Harrison. 2017. Complete chloroplast genomes from apomictic Taraxacum (Asteraceae): identity and variation between three microspecies. PLoS ONE 12(2): e0168008.
Soltis, P.S., D.E. Soltis and J.J Doyle. 1992. Molecular systematics of plant. Chapman and Hall. New York, USA.
Taberlet, P., L. Gielly, G. Patou and J. Bouvet. 1991. Universal primers for amplification of three noncoding regions of chloroplast DNA. Pl. Mol. Biol. 17:1105-1109.
Tsai, L.C., Y.C. Yu, H.M. Hsieh, J.C. Wang, A. Linacre and J.C. Lee. 2006. Species identification using sequences of the trnL intron and the trnL-trnF IGS of chloroplast genome among popular plants in Taiwan. J. Forensic Sci. 164:193-200.
Yun, K.W. and M. Kim. 2010. Korean medicinal plants. Shinkwang Publishing Co., Seoul, Korea. pp. 502-503.
*원문 PDF 파일 및 링크정보가 존재하지 않을 경우 KISTI DDS 시스템에서 제공하는 원문복사서비스를 사용할 수 있습니다.
오픈액세스 학술지에 출판된 논문
※ AI-Helper는 부적절한 답변을 할 수 있습니다.