[논문]치즈 유청의 오이모자이크바이러스와 고추모틀바이러스 감염 억제 효과

정봉남; 권선정; 최국선; 윤주연; 조인숙

doi:10.5423/rpd.2020.26.2.103

치즈 유청의 오이모자이크바이러스와 고추모틀바이러스 감염 억제 효과
Inhibitory Effect of Cheese Whey on Cucumber Mosaic Virus and Pepper Mottle Virus in Capsicum annuum 원문보기

Research in plant disease = 식물병연구, v.26 no.2, 2020년, pp.103 - 108

정봉남 (농촌진흥청 국립원예특작과학원 원예특작환경과) , 권선정 (서울대학교 그린바이오과학기술연구원) , 최국선 (농촌진흥청 국립원예특작과학원 원예특작환경과) , 윤주연 (농촌진흥청 국립원예특작과학원 원예특작환경과) , 조인숙 (농촌진흥청 국립원예특작과학원 원예특작환경과)

초록
AI-Helper

치즈 제조공정에서 나오는 부산물인 유청이 진딧물에 의해 전염되는 오이모자이크바이러스(cucumber mosaic virus, CMV)와 고추모틀바이러스(pepper mottle virus, PepMoV)의 감염 억제효과가 있는지를 고추 '청양' 품종을 대상으로 조사하였다. 온실에서 유청 원액 및 원액을 물로 2-20배로 희석하여 고추 '청양' 품종에 분무한 후 복숭아혹진딧물을 이용하여 CMV-Vch를 접종한 결과, 원액을 처리한 실험 구의 감염률이 6.6%로, 대조로 물을 처리한 실험 구의 감염률 23.3%에 비해 저하되었다. 노지에서 재배하는 고추 '청양' 품종에 CMV는 인위적으로 접종하지 않고 자연 감염되도록 둔 상태에서 정식일부터 6월 말일까지 1주일 간격으로 유청 원액을 분무 처리한 결과, 6월5일 이전에 자연적으로 CMV에 감염된 식물체의 비율이 무처리와 살충제 처리에 비해 각각 18.9%와 16.7% 감소하였다. 유청의 식물 바이러스 감염억제에 대한 작용 기작을 알기 위하여 온실에서 PepMoV-kr에 감염된 식물체 즙액과 유청을 1:1로 혼합하여 고추에 인공접종하여 시간경과에 따른 외피단백질 농도 변화를 웨스턴 블로팅 방법으로 분석한 결과, 접종 6일 후 대조에 비하여 적었으나, 접종 9일 후에는 대조와 동일하게 증가하였다. 본 연구 결과는 유청이 고추에 발생하는 서로 다른 속에 속하는 두 종류의 바이러스인 CMV와 PepMoV에 의한 감염 억제에 효과가 있다는 것을 보여주었다.

Abstract ▼ AI-Helper

Evaluations were made for the effects of cheese whey treatment on infection of pepper plants by cucumber mosaic virus-Vch (CMV-Vch) and pepper mottle virus-Kr (PepMoV-Kr). In a greenhouse, pepper plants sprayed with whey, prior to inoculation by CMV-Vch using aphids, showed a viral infection rate significantly lower (6.6%) than for the control (23.3%). In an open field experiment, in which CMV infection relied on natural transmission by aphids, pepper plants were sprayed with undiluted whey once a week, starting on the transplanting date (May 2) to the end of June. On June 5, these whey-sprayed plants showed a CMV infection rate reduced by 18.9% and 16.7%, compared to untreated and pesticide-treated plants, respectively. In the greenhouse, pepper plants inoculated with PepMoV-Kr mixed with whey showed a viral infection rate decreased by 60% compared to the control. The accumulated amount of PepMoV-Kr coat protein was less than that for the virus-only control at 6 days post inoculation (dpi), but increased up to a similar level as the control at 9 dpi. This study showed that cheese whey is effective in reducing infection of both CMV and PepMoV in pepper plants.

주제어

표/그림 (4)

표 Table 1. Percentage of pepper plants infected with cucumber mosaic virus-Vch (CMV-Vch) or pepper mottle virus-Kr (PepMoV-Kr)
그림 Fig. 1. Western blot analysis of the accumulation of coat protein (CP) of pepper mottle virus-Kr (PepMoV-Kr) within the upper leaves of pepper plants inoculated with a mixture of PepMoV-Kr–infected plant sap and cheese whey (1:1).
그림 Fig. 2. Percentage of pepper plants infected with cucumber mosaic virus (CMV) naturally in open fields.
그림 Fig. 3. Percentage of pepper plants infected with cucumber mosaic virus (CMV) naturally in open fields over time after planting.

AI 본문요약
AI-Helper

문제 정의

본 연구에서는 고추에 유청을 분무하여 바이러스 감염을 억제하는 효과가 있는지를 평가하기 위하여, 온실에서 고추모틀 바이러스(pepper mottle virus, PepMoV)에 감염된 고추 식물체의 즙액과 유청을 1:1로 혼합하여 고추에 인공 접종하여 시간 경과에 따른 외피단백질의 농도 변화를 분석하였다. 그리고 온실에서 오이모자이크바이러스(cucumber mosaic virus, CMV) 의 인공접종으로 바이러스 감염 억제 효과를 살펴보고, 노지에서 정식일로부터 유청 원액을 분무 처리하여 자연상태에서 진딧물에 의해 전염되는 CMV 감염을 억제하는 데 효과가 있는지를 조사하였다.
본 연구에서는 고추에 유청을 분무하여 바이러스 감염을 억제하는 효과가 있는지를 평가하기 위하여, 온실에서 고추모틀 바이러스(pepper mottle virus, PepMoV)에 감염된 고추 식물체의 즙액과 유청을 1:1로 혼합하여 고추에 인공 접종하여 시간 경과에 따른 외피단백질의 농도 변화를 분석하였다. 그리고 온실에서 오이모자이크바이러스(cucumber mosaic virus, CMV) 의 인공접종으로 바이러스 감염 억제 효과를 살펴보고, 노지에서 정식일로부터 유청 원액을 분무 처리하여 자연상태에서 진딧물에 의해 전염되는 CMV 감염을 억제하는 데 효과가 있는지를 조사하였다.

제안 방법

Louis, MO, USA)을 사용하였다. PepMoV 감염 여부 확인은 처리 10일 후에 접종한 잎 위쪽에 위치한 잎으로부터 RNeasy kit (Qiagen, Hilden, Germany)를 이용하여 추출한 식물체 전체 RNA와, PepMoV 외피단백질을 증폭하도록 제작된 PepMoV819F (AGCAGCTCAAGATCAGACACATTG)와 PepMoV-819R (CATTTCCCTGACCCCAAGCAAGGT) 프라이머를 사용하여, reverse transcription-polymerase chain reaction 방법으로 수행하였다.
노지재배지에서 유청의 처리는 희석하지 않고 원액을 고추 ’청양’ 품종에 정식 직후부터 1주일 간격으로 약 2개월(5월2일–6월30일) 동안 분무 처리하였다. 분무 방법은 식물체 잎 으로부터 유청액이 한두 방울 떨어지는 정도로 하였으며, 식물체 크기에 따라 한 그루를 뿌리는데 소요되는 양은 달랐으며, 초장 30, 60, 90 cm 크기의 식물체의 경우 각각 약 15, 20, 30 ml가 소요되었다. 대조는 유청 대신에 물을 사용하였다.
유청은 국립축산과학원으로부터 스트링치즈 제조 과정에서 나온 것을 분양 받아서 사용하였다(Supplementary Table 1). 온실에서의 실험은 유청 원액을 물로 2–20배 희석하여 처리하였다. 노지재배지에서 유청의 처리는 희석하지 않고 원액을 고추 ’청양’ 품종에 정식 직후부터 1주일 간격으로 약 2개월(5월2일–6월30일) 동안 분무 처리하였다.
온실 실험은 유청을 뿌린 후 1시간 30분–2시간 후에 CMV-Vch를 접종하였다. 접종 방법은 바이러스를 먹인 복숭아혹진딧물(Myzus persicae) 2–3령 충을 잎에 그루당 5마리씩 올려 놓았으며, 진딧물 접종에 관한 자세한 방법은 기 보고(Chung 등, 2013) 대로 수행하였다. 노지 재배지에서는 CMV를 인위적으로 접종하지 않고 자연감염되도 록 두었다.

대상 데이터

노지 및 온실 실험에 사용한 모든 식물 재료는 고추 ’청양’ 품종으로 진딧물 차단 시설이 된 유리온실에서 파종 후 30일된 묘를 사용하였다. 바이러스 접종원은 국립원예특작과학원에서 보유한 cucumber mosaic virus-Vch (CMV-Vch) (Cho 등, 2006)과 pepper mottle virus-Kr (PepMoV-Kr) (data not shown)이며, 고추에 감염시켜서 진딧물 차단을 위한 망 시설이 된 유리온실에서 유지하면서 온실 실험을 위한 바이러스 전염원으로 사용하였다.
노지 및 온실 실험에 사용한 모든 식물 재료는 고추 ’청양’ 품종으로 진딧물 차단 시설이 된 유리온실에서 파종 후 30일된 묘를 사용하였다. 바이러스 접종원은 국립원예특작과학원에서 보유한 cucumber mosaic virus-Vch (CMV-Vch) (Cho 등, 2006)과 pepper mottle virus-Kr (PepMoV-Kr) (data not shown)이며, 고추에 감염시켜서 진딧물 차단을 위한 망 시설이 된 유리온실에서 유지하면서 온실 실험을 위한 바이러스 전염원으로 사용하였다. 노지에서의 시험 처리구는 3개의 블럭으로 나누어서 배치하였으며, 블록당 처리 별로 50 그루를 심었다.
유청은 국립축산과학원으로부터 스트링치즈 제조 과정에서 나온 것을 분양 받아서 사용하였다(Supplementary Table 1). ;온실에서의 실험은 유청 원액을 물로 2–20배 희석하여 처리하였다. 노지재배지에서 유청의 처리는 희석하지 않고 원액을 고추 ’청양’ 품종에 정식 직후부터 1주일 간격으로 약 2개월(5월2일–6월30일) 동안 분무 처리하였다.

이론/모형

CMV 감염 여부에 대한 검정은 정식 20일 후부터 enzyme-linked immunosorbent assay 방법으로 Agdia (Elkhart, IN, USA) 제품을 사용하여 제조사에서 권장하는 실험절차대로 수행하였다.
PepMoV의 외피단백질 분석은 바이러스 접종 후 3일부터 9일까지 3일 간격으로 상엽을 채취하여 웨스턴 블로팅 방법을 이용하였으며, 자세한 웨스턴 블로팅 실험 방법은 기 보고대로(Chung 등, 2016) 수행하였다. 1차 항혈청은 국립원예특작과학원에서 제작한 PepMoV-Vch 다클론 항혈청을 사용하였으며, 2차 항혈청은 토끼에서 생산한 IgG와 alkaline phosphatase를 결합시킨 제품(Sigma-Aldrich, St.

성능/효과

PepMoV에 감염된 고추 식물체 즙액과 유청을 1:1로 혼합하여 온실에서 고추에 인공 접종한 결과, 바이러스 감염률이 대조에 비하여 60% 감소하였다(Table 1). PepMoV 접종 후의 외피 단백질 축적 양을 웨스턴 블로팅 방법으로 분석한 결과, 접종 6일 후 대조에 비하여 외피단백질 축적 양이 적었으나, 접종 9일 후에는 대조와 동일하게 증가하였다(Fig.
무처리와 살충제 처리구의 바이러스 감염률 차이가 크지 않은 것을 볼 수 있는데 이는 진딧물 밀도가 높은 시기에는, 약제를 살포하는 동안에 유시충 진딧물이 농약을 피해서 날랐다가 다시 방문하여 전염을 시키기 때문으로 추정되었다. 따라서 진딧물 밀도가 높고 재배지에 CMV 전염원이 많은 시기에는 바이러스병 방제에 살충제 처리효과가 크지 않을 것으로 판단되었다.

참고문헌 (23)

Abdelbacki, A. M., Taha, S. H., Sitohy, M. Z., Abou Dawood, A. I., Abd- El Hamid, M. M. and Rezk, A. A. 2010. Inhibition of Tomato Yellow Leaf Curl Virus (TYLCV) using whey proteins. Virol. J. 7: 26.

상세보기
Andersen, J. H., Osbakk, S. A., Vorland, L. H., Traavik, T. and Gutteberg, T. J. 2001. Lactoferrin and cyclic lactoferricin inhibit the entry of human cytomegalovirus into human fibroblasts. Antiviral Res. 51: 141-149.

상세보기
Cho, J.-D., Lee, S.-H., Kim, J.-S., Choi, G.-S., Kim, H.-R., Chung, B.-N. et al. 2006. Characteristics of Cucumber mosaic virus-VCH causing vein chlorosis on red pepper in Korea. Res. Plant Dis. 12: 226- 230. (In Korean)

원문보기 상세보기
Chung, B. N., Canto, T., Tenllado, F., Choi, K. S., Joa, J. H., Ahn, J. J. et al. 2016. The effects of high temperature on infection by Potato virus Y, Potato virus A, and Potato leafroll virus. Plant Pathol. J. 32: 321-328.

원문보기 상세보기
Chung, B. N., Choi, K. S., Ahn, J. J., Joa, J. H., Do, K. S. and Park, K.-S. 2015. Effects of temperature on systemic infection and symptom expression of Turnip mosaic virus in Chinese cabbage (Brassica campestris). Plant Pathol. J. 31: 363-370.

원문보기 상세보기
Chung, B. N., Yoon, J.-Y. and Palukaitis, P. 2013. Engineered resistance in potato against potato leafroll virus, potato virus A and potato virus Y. Virus Genes 47: 86-92.

상세보기
Clarke, N. M. and May, J. T. 2000. Effect of antimicrobial factors in human milk on rhinoviruses and milk-borne cytomegalovirus in vitro. J. Med. Microbiol. 49: 719-723.

상세보기
Farrell, H. M. Jr., Jimenez-Flores, R., Bleck, G. T., Brown, E. M., Butler, J. E., Creamer, L. K. et al. 2004. Nomenclature of the proteins of Cows' milk -sixth revision. J. Dairy Sci. 87: 1641-1674.

상세보기
Gillian, F. 2005. Milk as a management tool for virus diseases. URL http://www.omafra.gov.on.ca/english/crops/hort/news/grower/2005/11gn05a1.htm [23 June 2020].
Harmsen, M. C., Swart, P. J., de Bethune, M.-P., Pauwels, R., De Clercq, E., The, T. B. et al. 1995. Antiviral effects of plasma and milk proteins: lactoferrin shows potent activity against both human immunodeficiency virus and human cytomegalovirus replication in vitro. J. Infect. Dis. 172: 380-388.

상세보기
Hasegawa, K., Motsuchi, W., Tanaka, S. and Dosako, S. 1994. Inhibition with lactoferrin of in vitro infection with human herpes virus. Jpn. J. Med. Sci. Biol. 47: 73-85.

상세보기
Hu, J. S., Ferreira, S., Xu, M. Q., Lu, M., Iha, M., Pflum, E. et al. 1994. Transmission, movement and inactivation of Cymbidium mosaic and Odontoglossum ringspot viruses. Plant Dis. 78: 633-636.

상세보기
Lu, L., Hangoc, G., Oliff, A., Chen, L. T., Shen, R. N. and Broxmeyer, H. E. 1987. Protective influence of lactoferrin on mice infected with the polycythemia-inducing strain of Friend virus complex. Cancer Res. 47: 4184-4188.

상세보기
Mann, D. M., Romm, E. and Migliorini, V. 1994. Delineation of the glycosaminoglycan-binding site in the human inflammatory response protein lactoferrin. J. Biol. Chem. 269: 23661-23667.

상세보기
Marchetti, M., Longhi, C., Conte, M. P., Pisani, S., Valenti, P. and Seganti, L. 1996. Lactoferrin inhibits herpes simplex virus type 1 adsorption to Vero cells. Antiviral Res. 29: 221-231.

상세보기
Shimizu, K., Matsuzawa, H., Okada, K., Tazume, S., Dosako, S., Kawasaki, Y. et al. 1996. Lactoferrin-mediated protection of the host from murine cytomegalovirus infection by a T-cell-dependent augmentation of natural killer cell activity. Arch. Virol. 141: 1875-1889.

상세보기
Superti, F., Ammendolia, M. G., Valenti, P. and Seganti, L. 1997. Antirotaviral activity of milk proteins: lactoferrin prevents rotavirus infection in the enterocyte-like cell line HT-29. Med. Microbiol. Immunol. 186: 83-91.

상세보기
Swart, P. J., Harmsen, M. C., de Bethune, M. P., Pauwels, R., De Clercq, E., The, T. H. et al. 1996. Antiviral effects of plasma and milk proteins: lactoferrin shows potent antiviral activity on both HIV and HCMV replication in vitro in the same concentration range. Antiviral Res. 30: A35. (Abstract)

상세보기
Swart, P. J., Harmsen, M. C., Kuipers, M. E., Van Dijk, A. A., Van Der Strate, B. W. A., Van Berkel, P. H. C. et al. 1999. Charge modification of plasma and milk proteins results in antiviral active compounds. J. Pept. Sci. 5: 563-576.

상세보기
Waarts, B.-L., Aneke, O. J. C., Smit, J. M., Kimata, K., Bittman, R., Meijer, D. K. F. et al. 2005. Antiviral activity of human lactoferrin: inhibition of alphavirus interaction with heparan sulfate. Virology 333: 284-292.

상세보기
Wu, H. F., Monroe, D. M. and Church, F. C. 1995. Characterization of the glycosaminoglycan-binding region of lactoferrin. Arch. Biochem. Biophys. 317: 85-92.

상세보기
Yi, M., Kaneko, S., Yu, D. Y. and Murakami, S. 1997. Hepatitis C virus envelope proteins bind lactoferrin. J. Virol. 71: 5997-6002.

상세보기
Zapata, R. C., Singh, A., Pezeshki, A., Nibber, T. and Chelikani, P. K. 2017. Whey protein components - lactalbumin and lactoferrin - improve energy balance and metabolism. Sci. Rep. 7: 9917.

상세보기

저자의 다른 논문 :

표제어: PCR

동의어: Packet Collision Rate

용어 설명 출처 목록 (6)

용어 설명: PCR은 세균 특이성이 있는 primer를 이용하여 적은 수의 세균이 있을지라도 쉽게 검출할 수 있는 유용한 방법이며, 이를 이용하여 구강 내 치면세균막이나 타액에서 직접 세균을 검출할 수 있게 되었다[8].

내보내기 구분	파일저장 인쇄 메일전송
구성항목	기본정보 상세정보 관리번호, 논문명, 저널/프로시딩명, 저자 , 발행년, 권, 호, 시작페이지, 끝페이지, 발행기관 관리번호, 논문명, 대등논문명, 저자 , 저널/프로시딩명, 발행기관, 발행년, 발행언어, 권, 호, 시작페이지, 끝페이지, ISBN, ISSN, 주제분야, 키워드, 초록(한글), 초록(영문), 저자(소속기관)
저장형식	Text(ASCII format) Excel format RefWorks Direct Export RIS format (for Reference Manager, ProCite, EndNote), Scholar's Aids, Mendeley
메일정보	받는사람 (필수) @ 보내는사람 (선택) @ 제목 내용 KISTI 검색결과 이메일 서비스
안내	총 건의 자료가 검색되었습니다. 다운받으실 자료의 인덱스를 입력하세요. (1-10,000) 검색결과의 순서대로 최대 10,000건 까지 다운로드가 가능합니다. 데이타가 많을 경우 속도가 느려질 수 있습니다.(최대 2~3분 소요) 다운로드 파일은 UTF-8 형태로 저장됩니다. 파일의 내용이 제대로 보이지 않을실 때는 웹브라우저 상단의 보기 -> 인코딩 -> 자동선택 여부를 확인하십시오. ~ Text(ASCII format) Excel format

연합인증