[논문]D-Pinitol Promotes Apoptosis in MCF-7 Cells via Induction of p53 and Bax and Inhibition of Bcl-2 and NF-κB

Rengarajan, Thamaraiselvan; Nandakumar, Natarajan; Rajendran, Peramaiyan; Haribabu, Lingaiah; Nishigaki, Ikuo; Balasubramanian, Maruthaiveeran Periyasamy

doi:10.7314/apjcp.2014.15.4.1757

D-Pinitol Promotes Apoptosis in MCF-7 Cells via Induction of p53 and Bax and Inhibition of Bcl-2 and NF-κB 원문보기

Asian Pacific journal of cancer prevention : APJCP, v.15 no.4, 2014년, pp.1757 - 1762

Rengarajan, Thamaraiselvan (Department of Pharmacology and Environmental Toxicology, Dr. ALM PG Institute of Basic Medical Sciences, University of Madras) , Nandakumar, Natarajan (Department of Pharmacology and Environmental Toxicology, Dr. ALM PG Institute of Basic Medical Sciences, University of Madras) , Rajendran, Peramaiyan (NPO-International Laboratory of Biochemistry) , Haribabu, Lingaiah (Department of Pharmacology and Environmental Toxicology, Dr. ALM PG Institute of Basic Medical Sciences, University of Madras) , Nishigaki, Ikuo (NPO-International Laboratory of Biochemistry) , Balasubramanian, Maruthaiveeran Periyasamy (Department of Pharmacology and Environmental Toxicology, Dr. ALM PG Institute of Basic Medical Sciences, University of Madras)

Abstract ▼ AI-Helper

Development of drugs from natural products has been undergoing a gradual evoluation. Many plant derived compounds have excellent therapeutic potential against various human ailments. They are important sources especially for anticancer agents. A number of promising new agents are in clinical development based on their selective molecular targets in the field of oncology. D-pinitol is a naturally occurring compound derived from soy which has significant pharmacological activitites. Therefore we selected D-pinitol in order to evaluate apoptotic potential in the MCF-7 cell line. Human breast cancer cells were treated with different concentrations of D-pinitol and cytotoxicity was measured by MTT and LDH assays. The mechanism of apoptosis was studied with reference to expression of p53, Bcl-2, Bax and NF-kB proteins. The results revealed that D-pinitol significantly inhibited the proliferation of MCF-7 cells in a concentration-dependent manner, while upregulating the expression of p53, Bax and down regulating Bcl-2 and NF-kB. Thus the results obtained in this study clearly vindicated that D-pinitol induces apotosis in MCF-7 cells through regulation of proteins of pro- and anti-apoptotic cascades.

주제어

AI 본문요약
AI-Helper

* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.

제안 방법

The cDNA products were amplified for Bcl-2, Bax, NF-kB gene expression via PCR with Bcl-2,Bax,NF-kB specific primers as mentioned below, GAPDH as internal standard, GAPDH (Forward primer: CCATGAGTCCTTCCACGATACC),Bcl-2 (Forwardprimer: GGGAGAACGGGGTACGATA; Reverse primer: CATCTCCCGCATCCCACTC),Bax (Forward primer: TTCATCCAGGATCGAGCAGG; Reverse primer: TGAGACACTCGCTCAGCTTC), NF-κB (Forward primer: CCCCGCAGACTATCAATCCC; Reverse primer: ACTTACTGCCCCCTTCCAGA) for 30 cycles (30s at 95ºC, 2 min at 60ºC, 1 min at 72ºC) using a GeneAmp PCR System.

이론/모형

Cell viability was assessed as per the standard protocol by MTT (3-4,5-dimethylthiazol-2-yl-2,5- diphenyltetrazolium bromide) method of Mossmann (1983). The cell viability is calculated using the formula:%growth inhibition=(A570nm of treated cells/A570nm of control cells)×100.
Lactate dehydrogenase (LDH) leakage assay was performed by the method of Grivell and Berry, (1996). From the growth medium of experimental cultures, 100μl of sample were added to 1ml cuvette containing 0.
Total reduced glutathione (GSH) was determined by the method of Moron et al. (1979). Five percent of TCA was added to MCF-7 cells (1×10⁶ cells).

성능/효과

The levels of lactate dehydrogenase (LDH) released into the medium of control and D-pinitol treated at the concentration of 40 and 60μM (MCF-7) cells are presented in Figure 2. From the results it was observed that LDH activity was found to be significantly elevated after 24 hr of exposure in the medium containing D-pinitol when compared to the control. LDH leakage is considered as a marker of cytoxicity.
The results clearly confirmed that the exposure of D-pinitol at different concentrations such as 20, 40, 60, 80, 100 and 120μM for 24hr resulted in decrease of cell proliferation in a dose dependent manner.

후속연구

Therefore, it can be concluded that the induction of apoptosis may be an index for new antitumor drug selection and an important method of assessment for the clinical applications of many plant derived anti-cancer agents. Furthermore, the results obtained from our studies provides the basis for further investigation using animal models of carcinogenesis in order to judge the chemotherapeutic efficacy of D-pinitol.

참고문헌 (40)

Adlercreutz H (2002). Phyto-oestrogens cancer. Lancet Oncol, 3, 364-73.

상세보기
Andres S, Abraham K, Appel KE, Lampen A (2011). Risks benefits of dietary isoflavones for cancer. Crit Rev Toxicol, 41, 463-506.

상세보기
Chen Q, Galleano M, Cederbaum AI (1997). Cytotoxicity apoptosis produced by arachidonic acid in HepG2 cells over expressing human cytochrome P450 2E1. J Biol Chem, 272, 14532-41.

상세보기
Chomczynski P, Sacchi N (1987). The single-step method of RNA isolation by acid guanidinium thiocyanate-phenolchloroform extraction. Anal Biochem, 162, 156-9.
Dai C, Zhang B, Liu X, et al (2013). Pyrimethamine sensitizes pituitary adenomas cells to temozolomide through cathepsin B-dependent and caspase-dependent apoptotic pathways. Int J Cancer, 133, 1982-93.

상세보기
Elumalai P, Gunadharini D, Senthilkumar K, et al (2012). Ethanolic neem (Azadirachta indica A. Juss) leaf extract induces apoptosis and inhibits the IGF signaling pathway in breast cancer cell lines. Biomed and Preven Nutri, 2, 59-68.

상세보기
Feng Z, Levine AR (2010). The regulation of energy metabolism and the IGF-1/mTOR pathways by the p53 protein. Trends in Cell Biology, 20, 427-34.

상세보기
Giacinti L, Giacinti C, Gabellini C, et al (2012). Scriptaid effects on breast cancer cell lines. J Cell Physiol, 227, 3426-33.

상세보기
Grivell AR, Berry MN (1996). The effect of phosphate and substrate free incubation conditions on glycolysis in Enrich ascites tumor cells. Biochem Biophys Acta, 1291, 83-8.

상세보기
Guo-Ping Z, Kutbuddin D (2003). Subcellular location prediction of apoptosis proteins. Proteins: Structure, Function, Bioinformatics, 50, 44-8.
Kumar A, Takada Y, Boriek AM, et al (2004). Nuclear factorkB: its role in health and disease. J Mol Med, 82, 434-48.
Kumar N, Raj VP, Jayshree BS, et al (2012). Elucidation of structure-activity relationship of 2-quinolone derivatives and exploration of their antitumor potential through Baxinduced apoptotic pathway. Chem Biol Drug Des, 80, 291-9.

상세보기
Kumaravel M, Sankar P, Rukkumani R, et al (2012). Antiproliferative effect of an analog of curcumin bis- 1, 7-(2-hydroxyphenyl)-hepta-1, 6-diene-3, 5-dione in humanbreast cancer cells. Eur Rev Med Pharmacol Sci, 16, 1900-7.
Kuo LN, Huang CJ, Fang YC, et al (2009). Effect of thimerosal on Ca2? movement and viability in human oral cancer cells. Hum Exp Toxicol, 28, 301-8.

상세보기
Li Y, Li D, Yuan S, et al (2013). Embelin-induced MCF-7 breast cancer cell apoptosis and blockade of MCF-7 cells in the G2/M phase via the mitochondrial pathway. Oncol Lett, 5, 1005-9.

상세보기
Liu-Qin Y, Dian-Chun F, Rong-Quan W, et al (2004). Effect of NF-B, surviving, Bcl-2 and caspase 3 on apoptosis of gastric cancer cells induced by tumor necrosis factor releated apoptosis inducing ligand. World J Gastroenterol, 10, 22-5.

상세보기
Lowry OH, Rosebrough NJ, Farr AL, et al (1951). Protein measurement with the folin-phenol reagent. J Biol Chem, 193, 265-75.
Ma C, Xie JW, Kuang AR, et al (2009). The effects of antisense oligonucleotides Bcl-2/Bcl-xl and Bcl-2 on proliferation and apoptosis of breast cancer cells. Sichuan Da Xue Xue Bao Yi Xue Ban, 40, 780-3.

상세보기
Martin Brown J, Laura D (2005). The role of apoptosis in cancer development and treatment response. Nat Rev Cancer, 5, 231-7.

상세보기
Moon DO, Choi YH, Moon SK, et al (2011). Gossypol decreases tumor necrosis factor- $\alpha$ -induced intercellular adhesion molecule-1 expression via suppression of NF- ${\kappa}B$ activity. Food Chem Toxicol, 49, 999-1005.

상세보기
Moron MS, Depierre JW, Mannervik B (1979). Levels of glutathione reductase and glutathione-S-transferase activities in rat lung and liver. Biochim Biophys Acta, 582, 67-78.

상세보기
Mossmann T (1983). Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods, 65, 55-63.

상세보기
Nandakumar N, Rengarajan T, Haribabu L, et al (2011). Effect of flavonone hesperidin on the apoptosis of human mammary carcinoma cell line MCF-7. Biomed Prevent Nutr, 1, 207-15.

상세보기
Norhaizan ME, Ng SK, Norashareena MS, et al (2011). Antioxidant and cytotoxicity effect of rice bran phytic acid as an anticancer agent on ovarian, breast and liver cancer cell lines. Malays J Nutr, 17, 367-75.

상세보기
Ojeswi BK, Khoobchandani M, Hazra DK, et al (2010). Protective effect of Thuja occidentalis against DMBAinduced breast cancer with reference to oxidative stress. Hum Exp Toxicol, 29, 369-75.

상세보기
Papanikolaou V, Iliopoulos D, Dimou I, et al (2011). Survivin regulation by HER2 through NF- ${\kappa}B$ and c-myc in irradiated breast cancer cells. J Cell Mol Med, 15, 1542-50.

상세보기
Phillips DV, Dougherty DE, Smith AE (1982). Cyclitols in soybean. J Agri Food Chem, 30, 456-8.

상세보기
Ping-Chi H, Yu-Ting H, Mei-Ling T, et al (2004). Induction of apoptosis by shikonin through coordinative modulation of the Bcl-2 family, p27, and p53, release of cytochrome c, and sequential activation of caspases in human colorectal carcinoma cells. J Agric Food Chem, 52, 6330-7.

상세보기
Prasanna R, Harish CC, Pichai R, et al (2009). Anti-cancer effect of Cassia auriculata leaf extract in vitro through cell cycle arrest and induction of apoptosis in human breast and larynx cancer cell lines. Cell Biol Inter, 33, 127-34.

상세보기
Sato A, Kudo C, Yamakoshi H, et al (2011). Curcumin analog GO-Y030 is a novel inhibitor of IKKb that suppresses NF- ${\kappa}B$ signaling and induces apoptosis. Cancer Sci, 102, 1045-51.

상세보기
Sethi G, Ahn KS, Sung B, et al (2008). Pinitol targets nuclear factor-KB activation pathway leading to inhibition of gene products associated with proliferation, apoptosis, invasion, and angiogenesis. Mol Cancer Ther, 7, 1604-14.

상세보기
Sivakumar S, Palsamy P, Subramanian S (2010). Impact of D-pinitol on the attenuation of proinflammatory cytokines, hyperglycemia-mediated oxidative stress and protection of kidney tissue ultrastructure in streptozotocin-induced diabetic rats. Chem Biol Interact, 188, 237-45.

상세보기
Sivalokanathan S, Vijayababu MR, Balasubramanian MP (2006). Effects of Terminalia arjuna bark extract on apoptosis of human hepatoma cell line HepG2. World J Gastroenterol, 12, 1018-24.

상세보기
Tathagata C, Suman P, Munna LA, et al (2002). Curcumin induces apoptosis in human breast cancer cells through p53- dependent Bax induction. FEBS, 512, 334-40.

상세보기
Veronique B, Michael K (2009). Is NF-KB a good target for cancer therapy? Hopes pitfalls. Nat Rev Drug Discov, 8, 33-40.

상세보기
Wang CY, Mayo MW, Korneluk RG, et al (1998). NFkappaB antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and c-IAP2 to suppress caspase-8 activation. Science, 281, 1680-3.

상세보기
Williams JL, Ji P, Ouyang N, et al (2008). NO-donating aspirin inhibits the activation of NF-kappaB in human cancer cell lines and Min mice. Carcinogenesis, 29, 390-7.

상세보기
Wu X, Hawse JR, Subramaniam M, et al (2009). The tamoxifen metabolite, endoxifen, is a potent antiestrogen that targets estrogen receptor $\alpha$ for degradation in breast cancer cells. Cancer Res, 69, 1722.

상세보기
Xuea L, Schaldach CM, Janosik T, et al (2005). Effects of analogs of indole-e-carbinol cyclic trimerization product in human breast cancer cells. Chem Biol Interact, 152, 119-29.

상세보기
Zuo YB, Zeng AW, Yuan XG, Yu KT (2008). Extraction of soybean isoflavones from soybean meal with aqueous methanol modified supercritical carbon dioxide. J Food Eng, 89, 384-9.

상세보기

저자의 다른 논문 :

표제어: PCR

동의어: Packet Collision Rate

용어 설명 출처 목록 (6)

용어 설명: PCR은 세균 특이성이 있는 primer를 이용하여 적은 수의 세균이 있을지라도 쉽게 검출할 수 있는 유용한 방법이며, 이를 이용하여 구강 내 치면세균막이나 타액에서 직접 세균을 검출할 수 있게 되었다[8].

내보내기 구분	파일저장 인쇄 메일전송
구성항목	기본정보 상세정보 관리번호, 논문명, 저널/프로시딩명, 저자 , 발행년, 권, 호, 시작페이지, 끝페이지, 발행기관 관리번호, 논문명, 대등논문명, 저자 , 저널/프로시딩명, 발행기관, 발행년, 발행언어, 권, 호, 시작페이지, 끝페이지, ISBN, ISSN, 주제분야, 키워드, 초록(한글), 초록(영문), 저자(소속기관)
저장형식	Text(ASCII format) Excel format RefWorks Direct Export RIS format (for Reference Manager, ProCite, EndNote), Scholar's Aids, Mendeley
메일정보	받는사람 (필수) @ 보내는사람 (선택) @ 제목 내용 KISTI 검색결과 이메일 서비스
안내	총 건의 자료가 검색되었습니다. 다운받으실 자료의 인덱스를 입력하세요. (1-10,000) 검색결과의 순서대로 최대 10,000건 까지 다운로드가 가능합니다. 데이타가 많을 경우 속도가 느려질 수 있습니다.(최대 2~3분 소요) 다운로드 파일은 UTF-8 형태로 저장됩니다. 파일의 내용이 제대로 보이지 않을실 때는 웹브라우저 상단의 보기 -> 인코딩 -> 자동선택 여부를 확인하십시오. ~ Text(ASCII format) Excel format

연합인증