[논문]Clostridium butyricum 유래 Thiolase의 입체구조규명 연구

김언정; 김경진

doi:10.5352/jls.2016.26.3.353

Clostridium butyricum 유래 Thiolase의 입체구조규명 연구
Crystal Structure of Thiolase from Clostridium butyricum 원문보기

생명과학회지 = Journal of life science, v.26 no.3 = no.191, 2016년, pp.353 - 358

초록
AI-Helper

Thiolase는 두 분자의 acetyl-CoA를 중합하여 acetoacetyl-CoA를 생산하는 효소이다. 우리는 Clostridium butyricum 유래 thiolase (CbTHL)를 대장균에서 발현하고, 대량으로 정제하여 결정화에 성공하였다. 성장된 결정을 이용하여 엑스선회절 데이터를 획득하였으며, 3차원 입체구조를 2.0 Å으로 규명하였다. 전체적인 구조는 C. acetobutylicum 유래 thiolase (CaTHL)와 같은 type II biosynthetic thiolase와 매우 유사하다는 것을 확인하였다. CbTHL 구조를 CaTHL/CoA 복합체구조와 겹치기를 함으로써 활성화 잔기와 기질결합에 관여하는 잔기를 밝혀낼 수 있었다. CbTHL의 활성화부위는 3개의 잘 보존된 잔기인 Cys88, His349, Cys379로 구성되어 있으며, 이들 잔기는 각각, 공유결합친핵체, 일반염기, 2번째 친핵체의 역할을 하는 것으로 보인다. CbTHL에서 기질결합은, β-mercaptoethyamine과 pantothenic acid 부위는 타 thiolase와 매우 유사한 방법으로 안정화 되지만, ADP 부분은 타 thiolase와는 달리 매우 특이적인 잔기들을 사용한다. CbTHL 구조에서 가장 특징적인 것은 본 단백질이 가역적 이황화결합을 매개로 산화환원스위치를 통하여 그 활성을 조절한다는 것이다.

Abstract ▼ AI-Helper

Thiolase is an enzyme that catalyzes condensation reactions between two acetyl-CoA molecules to produce acetoacetyl-CoA. As thiolase catalyzes is the first reaction in the production of n-butanol, knowledge of the molecular and regulatory mechanism of the enzyme is crucial for synthesizing high-value biofuel. Thiolase from Clostridium butyricum (CbTHL) was expressed, purified, and crystallized. X-ray diffraction data were collected from the crystals, and the 3-dimentional structure of the enzyme was determined at 2.0 Å. The overall structure of thiolase was similar to that of type II biosynthetic thiolases, such as thiolase from C. acetobutylicum (CaTHL). The superposition of this structure with that of CaTHL complexed with CoA revealed the residues that comprise the catalytic and substrate binding sites of CbTHL. The catalytic site of CbTHL contains three conserved residues, Cys88, His349, and Cys379, which may function as a covalent nucleophile, general base, and second nucleophile, respectively. For substrate binding, the way in which CbTHL stabilized the ADP moiety of CoA was unlike that of other thiolases, whereas the stabilization of β-mercaptoethyamine and pantothenic acid moieties of CoA was quite similar to that of other enzymes. The most interesting observation in the CbTHL structure was that the enzyme was regulated through redox-switch modulation, using a reversible disulfide bond.

주제어

AI 본문요약
AI-Helper

* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.

문제 정의

이는 환원된 환경에서 CaTHL이 활성을 가지며 n-butanol이 합성되고 산화된 환경에서 비활성으로 전환되며 결과적으로 n-butanol의 합성이 저해되는 것으로 알려져 있다. 본 연구에서는 C. acetobutylicum과 같은 속에 속하면서 n-butanol의 합성능력을 가지고 있는 C. butyricum 유래 THL (CbTHL)의 분자수준의 입체구조를 엑스선회절 방법을 통하여 규명하였으며, 이를 통하여 CbTHL이 CaTHL과 같이 환경의 산화환원적 변화에 따라 산화환원스위치로 그 기능을 조절하는 것을 보고한다.

제안 방법

5 ml을 미리분주해놓고 cover slip이 고정될 수 있도록 바세린을 발라준다. 10일이 지난 후 CbTHL의 결정을 현미경을 통해 볼 수 있었는데, 결정화 조건은 35% 2-methyl-2, 4-pentanediol, 0.1 M imi- dazole pH 8.0, 0.2 M MgCl₂에서 결정을 만들었다.
CbTHL를 암호화하는 유전자는 C. butyricum chromosomal DNA을 주형으로 사용하여 PCR방법을 통하여 증폭하였다 (Met1- Met 393, MW. 41 kDa). 증폭된 DNA 단편을 pQE30a 벡터에 클로닝하였으며 제한효소는 BamH₁과 Xho1을 사용하였다.
32 Å³ Da^-1이며 대략, 용매 함유율은 47%이다. CbTHL의 구조는 유사한 CaTHL (아미노산 서열 유사성이 73%)을 기반으로 MOLREP을 사용한 분자 대체 방법으로 규명하였다[17]. 그리고 모델빌딩은 COOT 프로그램을 사용하여 수행하고, CCP4i에 REFMAC₅ 프로그램을 동시에 사용하여 구조를 규명할 수 있었다[4, 25, 30].
CbTHL의 입체구조 규명을 위하여 pQE30a 벡터 시스템을이용하여 E. coli에서 발현하고, Ni-NTA, size-exclusion chro- matography방법을 이용하여 순도 95 % 이상의 단백질을 대량생산하였다. 정제된 CbTHL의 단백질을 사용하여 결정화를 시도하였으며 35% 2-methyl-2, 4-pentanediol, 0.
고순도로 정제된 단백질을 결정화 하기 위해서 햄턴 리서치와 에매랄드 바이오시스템에서 판매되는 스크린 키트를 사용하여 hanging-drop vapor 확산 방법을 이용하여 22℃ 인큐베이터에 보관해둔다. Hanging drop방법은 cover slip위에 정제된 단백질(농도 30 mg/ml, 20 mM Tris-HCl pH 8.
CbTHL의 구조는 유사한 CaTHL (아미노산 서열 유사성이 73%)을 기반으로 MOLREP을 사용한 분자 대체 방법으로 규명하였다[17]. 그리고 모델빌딩은 COOT 프로그램을 사용하여 수행하고, CCP4i에 REFMAC₅ 프로그램을 동시에 사용하여 구조를 규명할 수 있었다[4, 25, 30].
2 M MgCl₂조건에서 양질의 결정성장에 성공하였다. 엑스선회절 데이터는 포항방사광가속기에서 획득하였으며, 본 연구진에서 규명한 CaTHL의 입체구조를 모델로 사용하여 CbTHL의 입체구조를 2.0 Å 해상도로 규명하였다. CbTHL의 입체구조는 엑스선결정학적 통계치에 모두 부합하며, Table 1에 상세히 기술되어 있다.
coli에서 발현하고, Ni-NTA, size-exclusion chro- matography방법을 이용하여 순도 95 % 이상의 단백질을 대량생산하였다. 정제된 CbTHL의 단백질을 사용하여 결정화를 시도하였으며 35% 2-methyl-2, 4-pentanediol, 0.1 M imida- zole pH 8.0, 0.2 M MgCl₂조건에서 양질의 결정성장에 성공하였다. 엑스선회절 데이터는 포항방사광가속기에서 획득하였으며, 본 연구진에서 규명한 CaTHL의 입체구조를 모델로 사용하여 CbTHL의 입체구조를 2.
15]. 최근 본 연구진에서는 acetyl-CoA acetyl transferase (THL) [13], 3-hydroxybutyryl-CoA reductase (HBD) [9], crotonase (CRT) [10] 등 C. acetobutylicum 유래 n-butanol의 생합성에 관여하는 효소들의 입체구조규명 및 생화학적 특성연구를 수행하였다. 이들 효소들 중 THLe 2분자의 acetyl-CoA를 ace- toacetyl-CoA로 중합하는 반응을 수행하며 n-butanol의 생합성 첫 번째 반응에 관여하는 효소이다.

대상 데이터

CbTHL에 대한 결정화의 데이터 수집은 포항 가속기연구소 내에 7A 빔라인에서 실험을 수행하였고, QUANTUM 270 CCD detector(San Diego, CA, USA)를 사용하고 파장은 1 Å 이었다. CbTHL결정의 엑스레이 회절은 해상도 2.
41 kDa). 증폭된 DNA 단편을 pQE30a 벡터에 클로닝하였으며 제한효소는 BamH₁과 Xho1을 사용하였다. 재조합 단백질 클로닝을 위해 프라이머는 5’-GCGCG GGATCCATGAAA GACGTAGTTATAGTAAGCGC-3’와 5’- GCGCGCTCGAGTTACATTCTTTCAACGAT GACAGCAG- 3’을 사용하였다.

데이터처리

0Å으로 데이터를 수집할 수 있었다. 수집한 데이터는 index, integration, scale과정을 HKL2000 프로그램을 사용하여 수행하였다[27]. 그 결과 CbTHL의 공간군(Space group)은 P2₁2₁2₁이며, 단위 격자의 크기는 a=95.

성능/효과

0, 200 mM NaCl이 들어있는 버퍼 안에 단백질 농도는 30 mg/ml이며 -80℃ 냉동고에 보관해두었다. SDS-PAGE로 정제된 단백질이 싱글밴드이며 사이즈는 41 kDa으로 확인할 수 있었다.
수집한 데이터는 index, integration, scale과정을 HKL2000 프로그램을 사용하여 수행하였다[27]. 그 결과 CbTHL의 공간군(Space group)은 P2₁2₁2₁이며, 단위 격자의 크기는 a=95.132, b=116.096, c=169.832이며 α=β=γ= 90°였다. 1개의 비대칭 단위에 4개 분자가 존재하며 Matthews coefficient는 2.

후속연구

이러한 사실은 혐기성균주 유래 THLe 환경의 산화환원적 변화에 따라 그 기능을 조절하는 산화환원스위치로 기능을 조절하는 것을 의미하며 호기성균주 유래 THLe 이와 달리 이황화결합을 형성하지 않고 비교적 환경의 산화환원적 변화에 둔감하다는 것을 의미한다. 본 연구는 THL의 조절기작이 산소의 민감도가 다른 균주에 따라 다르다는 것을 보여주는 중요한 결과를 보여주고 있으며 n-butanol의 생산성 증가를 위한 중요한 구조적 정보도 제공해 줄 것으로 기대된다.

참고문헌 (30)

Atsumi, S., Hanai, T. and Liao, J. C. 2008. Non-fermentative pathways for synthesis of branched-chain higher alcohols as biofuels. Nature 451, 86-89.

상세보기
Durre, P. 2007. Biobutanol: an attractive biofuel. Biotechnol. J. 2, 1525-1534.

상세보기
Durre, P. 2008. Fermentative butanol production: bulk chemical and biofuel. Ann. N.Y. Acad. Sci. 1125, 353-362.

상세보기
Emsley, P. and Cowtan, K. 2004. Coot: model-building tools for molecular graphics. Acta Crystallogr. D Biol. Crystallogr. 60, 2126-2132.

상세보기
Ezeji, T., Milne, C., Price, N. D. and Blaschek, H. P. 2010. Achievements and perspectives to overcome the poor solvent resistance in acetone and butanol-producing microorganisms. Appl. Microbiol. Biotechnol. 85, 1697-1712.

상세보기
Felnagle, E. A., Chaubey, A., Noey, E. L., Houk, K. N. and Liao, J. C. 2012. Engineering synthetic recursive pathways to generate non-natural small molecules. Nat. Chem. Biol. 8, 518-526.

상세보기
Inui, M., Suda, M., Kimura, S., Yasuda, K., Suzuki, H., Toda, H., Yamamoto, S., Okino, S., Suzuki, N. and Yukawa, H. 2008. Expression of clostridium acetobutylicum butanol synthetic genes in Escherichia coli. Appl. Microbiol. Biotechnol. 77, 1305-1316

상세보기
Jones, D. T. and Woods, D. R. 1986. Acetone-butanol fermentation revisited. Microbiol. Rev. 50, 484-524.

상세보기
Kim, E. J., Kim, J., Ahn, J. W., Kim, Y. J., Chang, J. H. and Kim, K. J. 2014. Crystal structure of (S)-3-Hydroxybutyryl- CoA dehydrogenase from clostridium butyricum and its mutations that enhance reaction kinetics. J. Microbiol. Biotechnol. 24, 1636-1643.

원문보기 상세보기
Kim, E. J., Kim, Y. J. and Kim, K. J. 2014. Structural insights into substrate specificity of crotonase from the n-butanol producing bacterium clostridium acetobutylicum. Biochem. Biophys. Res. Commun. 451, 431-435.

상세보기
Kim, E. J., Son, H. F., Kim, S., Ahn, J. W. and Kim, K. J. 2014. Crystal structure and biochemical characterization of beta-keto thiolase B from polyhydroxyalkanoate-producing bacterium Ralstonia eutropha H16. Biochem. Biophys. Res. Commun. 444, 365-369.

상세보기
Kim, E. J. and Kim, K. J. 2014. Crystal structure and biochemical characterization of PhaA from Ralstonia eutropha, a polyhydroxyalkanoate-producing bacterium. Biochem. Biophys. Res. Commun. 452, 124-129.

상세보기
Kim, S., Jang, Y. S., Ha, S. C., Ahn, J. W., Kim, E. J., Lim, J. H., Cho, C., Ryu, Y. S., Lee, S. K., Lee, S. Y. and Kim, K. J. 2015. Redox-switch regulatory mechanism of thiolase from clostridium acetobutylicum. Nat. Commun. 6, 8410.

상세보기
Kursula, P., Sikkilä, H., Fukao, T., Kondo, N. and Wierenga, R. K. 2005. High resolution crystal structures of human cytosolic thiolase (CT): acomparison of the active sites of human CT, bacterial thiolase, andbacterial KAS I. J. Mol. Biol. 347, 189-201.

상세보기
Lee, S. K., Chou, H., Ham, T. S., Lee, T. S. and Keasling, J. D. 2008. Metabolic engineering of microorganisms for biofuels production: from bugs to synthetic biology to fuels. Curr. Opin. Biotechnol. 19, 556-563.

상세보기
Lee, S. Y., Park, J. H., Jang, S. H., Nielsen, L. K., Kim, J. and Jung, K. S. 2008. Fermentative butanol production by clostridia. Biotechnol. Bioeng. 101, 209-228.

상세보기
Matthews, B. W. 1968. Solvent content of protein crystals. J. Mol. Biol. 33, 491-497.

상세보기
Mitchell, W. J. 1998. Physiology of carbohydrate to solvent conversion by clostridia. Adv. Microb. Physiol. 39, 31-130.
Mathieu, M., Zeelen, J. P., Pauptit, R. A., Erdmann, R., Kunau, W. H. and Wierenga, R. K. 1994. The 2.8 A crystal structure of peroxisomal 3-ketoacyl-CoA thiolase of Saccharomyces cerevisiae: a five-layered alpha beta alpha beta alpha structure constructed from two core domains of identical topology. Structure 2, 797-808.

상세보기
Mathieu, M., Zeelen, J. P., Pauptit, R. A., Erdmann, R., Kunau, W. H. and Wierenga, R. K. 1997. The 1.8 A crystal structure of the dimeric peroxisomal 3-ketoacyl-CoA thiolase of Saccharomyces cerevisiae: implications for substrate binding and reaction mechanism. J. Mol. Biol. 273, 714-728.

상세보기
Meriläinen, G., Poikela, V., Kursula, P. and Wierenga, R. K. 2009. The thiolase reaction mechanism: the importance of Asn316 and His348 forstabilizing the enolate intermediate of the Claisen condensation. Biochemistry 48, 11011-11025.

상세보기
Meriläinen, G., Schmitz, W., Wierenga, R. K. and Kursula, P. 2008. The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productivemode of substrate binding in bacterial biosynthetic thiolase, a thioester dependent enzyme. FEBS J. 275, 6136-6148.

상세보기
Modis, Y. and Wierenga, R. K. 1999. A biosynthetic thiolase in complex with areaction intermediate: the crystal structure provides new insights into the catalytic mechanism. Structure 7, 1279-1290.

상세보기
Modis, Y. and Wierenga, R. K. 2000. Crystallographic analysis of the reaction pathway of Zoogloea ramigera biosynthetic thiolase. J. Mol. Biol. 297, 1171-1182.

상세보기
Murshudov, G. N., Vagin, A. A. and Dodson, E. J. 1997. Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr. D Biol. Crystallogr. 53, 240-255.

상세보기
Nielsen, D. R., Leonard, E., Yoon, S. H., Tseng, H. C., Yuan, C. and Prather, K. L. 2009. Engineering alternative butanol production platforms in heterologous bacteria. Metab. Eng. 11, 262-273.

상세보기
Otwinowski, Z. and Minor, W. 1997. Processing of X-ray diffraction data. Methods Enzymo. 276, 307-326.
Papoutsakis, E. T. 2008. Engineering solventogenic clostridia. Curr.Opin. Biotechnol. 19, 420-429.

상세보기
Steen, E. J., Chan, R., Prasad, N., Myers, S., Petzold, C. J., Redding, A., Ouellet, M. and Keasling, J. D. 2008. Metabolic engineering of Saccharomyces cerevisiae for the production of n-butanol. Microb. Cell Fact. 7, 36.

상세보기
Vagin, A. and Teplyakov, A. 2010. Molecular replacement with MOLREP. Acta Crystallogr. D Biol. Crystallogr. 66, 22-25.

상세보기

저자의 다른 논문 :

표제어: PCR

동의어: Packet Collision Rate

용어 설명 출처 목록 (6)

용어 설명: PCR은 세균 특이성이 있는 primer를 이용하여 적은 수의 세균이 있을지라도 쉽게 검출할 수 있는 유용한 방법이며, 이를 이용하여 구강 내 치면세균막이나 타액에서 직접 세균을 검출할 수 있게 되었다[8].

내보내기 구분	파일저장 인쇄 메일전송
구성항목	기본정보 상세정보 관리번호, 논문명, 저널/프로시딩명, 저자 , 발행년, 권, 호, 시작페이지, 끝페이지, 발행기관 관리번호, 논문명, 대등논문명, 저자 , 저널/프로시딩명, 발행기관, 발행년, 발행언어, 권, 호, 시작페이지, 끝페이지, ISBN, ISSN, 주제분야, 키워드, 초록(한글), 초록(영문), 저자(소속기관)
저장형식	Text(ASCII format) Excel format RefWorks Direct Export RIS format (for Reference Manager, ProCite, EndNote), Scholar's Aids, Mendeley
메일정보	받는사람 (필수) @ 보내는사람 (선택) @ 제목 내용 KISTI 검색결과 이메일 서비스
안내	총 건의 자료가 검색되었습니다. 다운받으실 자료의 인덱스를 입력하세요. (1-10,000) 검색결과의 순서대로 최대 10,000건 까지 다운로드가 가능합니다. 데이타가 많을 경우 속도가 느려질 수 있습니다.(최대 2~3분 소요) 다운로드 파일은 UTF-8 형태로 저장됩니다. 파일의 내용이 제대로 보이지 않을실 때는 웹브라우저 상단의 보기 -> 인코딩 -> 자동선택 여부를 확인하십시오. ~ Text(ASCII format) Excel format

연합인증