Phospholipase C zeta 유전자의 유전적다형성과 돼지 액상정액의 운동학적 특성과의 연관성 분석 Association study analysis of phospholipase C zeta gene polymorphism forsperm motility and kinematic characteristics in liquid semen of Boar원문보기
For evaluating the boar semen quality, sperm motility is an important parameter because the movement of sperm indicates active metabolism, membrane integrity and fertilizing capacity. Phospholipase C zeta (PLCz) is important enzyme in spermatogenesis, but the effect has not been confirmed in pigs ye...
For evaluating the boar semen quality, sperm motility is an important parameter because the movement of sperm indicates active metabolism, membrane integrity and fertilizing capacity. Phospholipase C zeta (PLCz) is important enzyme in spermatogenesis, but the effect has not been confirmed in pigs yet. Therefore, this study was aimed to analyze their association with sperm motility and kinematic characteristics. DNA samples from 124 Duroc pigs with records of sperm motility and kinematic characteristics [total motile spermatozoa (MOT), curvilinear velocity (VCL), straight-line velocity (VSL), the ratio between VSL and VCL (LIN), amplitude of lateral head displacement (ALH)] were subjected. A SNP in non-coding region of PLCz g.158 A > C was associated with MOT (p < 0.05), VCL (p < 0.01), LIN (p < 0.01) and ALH (p < 0.05) in Duroc population. Therefore, we suggest that the intron region of the porcine PLCz gene may be used as a molecular marker for Duroc boar semen quality, although its functional effect was not defined yet. Whether the association is due to the candidate gene or not require further verification. Thus, it will be of interest to continue association studies in the regions surrounding those genes.
For evaluating the boar semen quality, sperm motility is an important parameter because the movement of sperm indicates active metabolism, membrane integrity and fertilizing capacity. Phospholipase C zeta (PLCz) is important enzyme in spermatogenesis, but the effect has not been confirmed in pigs yet. Therefore, this study was aimed to analyze their association with sperm motility and kinematic characteristics. DNA samples from 124 Duroc pigs with records of sperm motility and kinematic characteristics [total motile spermatozoa (MOT), curvilinear velocity (VCL), straight-line velocity (VSL), the ratio between VSL and VCL (LIN), amplitude of lateral head displacement (ALH)] were subjected. A SNP in non-coding region of PLCz g.158 A > C was associated with MOT (p < 0.05), VCL (p < 0.01), LIN (p < 0.01) and ALH (p < 0.05) in Duroc population. Therefore, we suggest that the intron region of the porcine PLCz gene may be used as a molecular marker for Duroc boar semen quality, although its functional effect was not defined yet. Whether the association is due to the candidate gene or not require further verification. Thus, it will be of interest to continue association studies in the regions surrounding those genes.
* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.
문제 정의
따라서 본 연구에서는 유전자를 돼지정액의 품질과 연관성이 높다고 알려진 PLCz 유전자를 판별하였고 기존 논문의 유전전적 다형성의 유전자형을 분석 하였으며, 돼지 액상정액의 운동학적 특성과 연관성이 있는지 알아 보고자 하였다.
본 연구에서는 정액의 운동성과 연관성이 있는 PLCz의 SNP를 확인하여 두록 124두에 대해 유전자형을 분석하고 액상정액의 운동학적 특성과 연관성이 있는지 알아 보고자 하였다. PLCz 유전자의 인트론 1번 지역의 SNP를 확인한 결과 이전 논문과 동일하게 g.
제안 방법
정자샘플은 BTS로 희석하여 30×106 cells/ml 농도로 준비하였다. 5㎕의 정자샘플을 38℃로 가온된 pre-warmed markler counting chamber(Sefi-Medical Instruments, Israel)에 올려놓고 샘플 당 최소 100마리의 정자를 평가하였으며, 분석은 4회 이상 실시하였다. 각 정자 샘플의 전체 운동성(TMS, Total motile spermatozoa, %), 곡선속도(VCL, Curvilinear velocity, um/s), 직선속(VSL, Straight-line velocity, um/s), 평균이동속도(VAP, Average path velocity), 직진성(LIN, e.
Sequencing을 하기 위한 genomic DNA는 수퇘지의 혈액에서 Wizard Genomic DNA Purification Kit를 사용하여 제조사의 방법을 약간 변형하여 분리 하였다(Promega, Madison, WI, USA). Direct sequencing을 위하여 두록 수퇘지 124두의 DNA를 이용하여 PCR(Polymerase chain reaction)을 수행하였다. PCR은 10pml의 primer, 0.
PCR 수행 후 염기서열 분석을 위하여 Big Dye Terminator Cycle Sequencing Ready Reaction Kit V3.0 (Life Technologies Corp., Carlsbad, CA, USA)와 ABI PRISM® 3730 Genetic Analyzer (Life Technologies Corp.)를 이용하여 염기서열 분석을 하였고 SeqMan program (DNASTAR Inc., Madison, WI, USA)을 이용하여 SNP(Sngle nucleotide polymorphism)를 비교하여 유전자형을 결정하였다.
PCR 조건은 94°C에서 30초, 64°C에서 30초 그리고 72°C에서 45초를 수행하였고 DNA Engine Tetrad® 2 Thermal Cycler(Bio-Rad, Hercules, CA, USA)를 이용하여 총 35반복으로 PCR을 수행하였다.
PCR은 10pml의 primer, 0.25mM dNTP, 10X PCR buffer, 1.25unit DNA polymerase(Genet Bio, Chungnam, Korea)와 100ng의 DNA를 포함하여 20μl의 부피에서 수행하였다.
Sequencing을 하기 위한 genomic DNA는 수퇘지의 혈액에서 Wizard Genomic DNA Purification Kit를 사용하여 제조사의 방법을 약간 변형하여 분리 하였다(Promega, Madison, WI, USA). Direct sequencing을 위하여 두록 수퇘지 124두의 DNA를 이용하여 PCR(Polymerase chain reaction)을 수행하였다.
5㎕의 정자샘플을 38℃로 가온된 pre-warmed markler counting chamber(Sefi-Medical Instruments, Israel)에 올려놓고 샘플 당 최소 100마리의 정자를 평가하였으며, 분석은 4회 이상 실시하였다. 각 정자 샘플의 전체 운동성(TMS, Total motile spermatozoa, %), 곡선속도(VCL, Curvilinear velocity, um/s), 직선속(VSL, Straight-line velocity, um/s), 평균이동속도(VAP, Average path velocity), 직진성(LIN, e.g., the ratio between VSL and VCL), ALH(Amplitude of Lateral Head displacement)를 포함하는 운동학적 특성들을 측정했다. 두록 124두 에 대한 정액에 대한 평가결과는 table 1에 제시하였다.
대상 데이터
수퇘지들은 농촌진흥청 국립축산과학원에서 동일한 품종, 동일한 환경조건 하에서 사육되었다. 공시축은 2012년에서 2015년까지 1.5~2년생의 성숙한 두록 수태지 124두를 사용하였으며, 정액 채취는 의빈대를 이용한 수압법을 이용하였다. 본 연구에 사용된 정액은 정자 운동성과 형태학적으로 정상인 정자의 비율이 80% 이상인 사출정액만을 이용했다.
5~2년생의 성숙한 두록 수태지 124두를 사용하였으며, 정액 채취는 의빈대를 이용한 수압법을 이용하였다. 본 연구에 사용된 정액은 정자 운동성과 형태학적으로 정상인 정자의 비율이 80% 이상인 사출정액만을 이용했다. 채취한 정액은 정액필터를 통해 1차적으로 걸러진 정액을 37℃ BTS (Beltsville thawing solution)와 1 : 1 비율로 희석하여 신속히 실험실로 운반하였다.
수퇘지들은 농촌진흥청 국립축산과학원에서 동일한 품종, 동일한 환경조건 하에서 사육되었다. 공시축은 2012년에서 2015년까지 1.
데이터처리
연관성분석은 SAS 9.13(SAS Institute Inc., Cary, NC, USA)의 generalized linear model(GLM)을 이용하였으며, 유전자형의 효과와 경제형질들에 대해 최소 유의차 검정으로 평균간 차이에 대한 유의성을 조사하였다. 통계분석에 이용한 모형은 다음과 같다.
이론/모형
, Madison, WI, USA)을 이용하여 SNP(Sngle nucleotide polymorphism)를 비교하여 유전자형을 결정하였다. 염기서열분석에 이용된 primer는 기존 논문에 있는 염기서열을 사용하였다. 염기서열은 5′- GGTGTTCAGACCGAAAGGAA -3′ and 5′- AACAGAAAGGACTTCTGATGTGA -3′를 사용하였다(Kaewmala 등, 2011).
두록 124두의 유전자형을 확인하여 액상정액의 6가지 운동학적 특성과 연관성을 분석한 결과 table 3과 같이 MOT, VCL, LIN 그리고 ALH 4가지 운동학적 특성에서 높은 유의성을 확인 할 수 있었다(p=0.0249, p=0.0099, p=0.0008, p=0.0191). 2011년 Kaewmala 등의 논문에는 g.
하지만 본 연구에서는 불행히도 정액의 농도 정보가 존재하지 않아서 연관성 분석을 할 수 없었다. 또한 기존 결과와는 다르게 MOT와 높은 연관성이 있음을 확인할 수있었다. 이러한 결과들은 2011년 Kaewmala 등의 논문외에 다른 결과들은 찾을 수 없었지만 정액의 품질이 품종간의 차이가 난다는 것들이 보고가 되었기 때문에 기존의 논문과 다른 결과가 나온 것이 품종간의 차이일 수도 있다.
후속연구
그리고 국내에서 많은 수의 수퇘지를 보유할 수 없기 때문에 연구자 간의 협업도 필요할 것으로 생각되어진다. 결론적으로 이러한 연구는 돼지의 액상정액 품질을 결정할 수 있는 기초적인 자료로 활용 가능할 것인라고 사료된다.
158 A > C SNP가 두록 액상정액의 정자 운동성과 연관성이 높다고 판단 하였다. 하지만 이러한 연구들이 앞으로 품종 특이적인 효과와 다른 집단에서도 연구들이 고려되어져야 할 것이다. 그리고 국내에서 많은 수의 수퇘지를 보유할 수 없기 때문에 연구자 간의 협업도 필요할 것으로 생각되어진다.
질의응답
핵심어
질문
논문에서 추출한 답변
인공수정용 정액은 어떻게 구분할 수 있는가?
이러한 인공수정은 전세계적으로 보급률이 매년 증가해오고 있으며, 국내 돼지 인공수정 보급률은 90% 이상에 이르고 있다. 인공수정용 정액은 크게 두 가지 형태로 구분되어 질 수 있는데, 수퇘지로부터 채정한 원정액을 정액희석제와 희석하여 냉장상태로 보관하였다가 사용하는 액상정액(Fresh liquid semen)과 정액을 동결하여 -196℃ 액체질소에 보관하였다가 해동하여 사용하는 동결정액(Frozen semen)이 있다. 하지만 동결정액의 해동후, 활성도 및 수태율 저하에 따른 부작용으로 상업용 비육돼지 생산에 사용되는 인공수정용 정액은 95% 이상이 액상정액을 사용하고 있다.
돼지 인공수정 기술의 장점은?
돼지 번식은 양돈산업에 있어서 경제성에 아주 중요한 요인중의 하나이다. 돼지 인공수정은 자연교배에 비해 질병의 위험에 최소화 할 수 있고, 유전능력이 우수한 씨수퇘지의 유전자를 다음세대에 효율적으로 전달 할 수 있어 개량의 속도를 높일 수 있는 장점을 가진 매우 유용한 기술이다(Maes e 등, 2008). 이러한 인공수정은 전세계적으로 보급률이 매년 증가해오고 있으며, 국내 돼지 인공수정 보급률은 90% 이상에 이르고 있다.
국내 돼지 인공수정 대부분에 동결정액이 아니라 액상정액을 사용하는 이유는?
인공수정용 정액은 크게 두 가지 형태로 구분되어 질 수 있는데, 수퇘지로부터 채정한 원정액을 정액희석제와 희석하여 냉장상태로 보관하였다가 사용하는 액상정액(Fresh liquid semen)과 정액을 동결하여 -196℃ 액체질소에 보관하였다가 해동하여 사용하는 동결정액(Frozen semen)이 있다. 하지만 동결정액의 해동후, 활성도 및 수태율 저하에 따른 부작용으로 상업용 비육돼지 생산에 사용되는 인공수정용 정액은 95% 이상이 액상정액을 사용하고 있다. 앞에서 언급한바와 같이 국내 돼지 인공수정은 액상정액이 많은 부분을 차지하고 있고 인공수정 보급율도 대다수를 차지하고 있다.
참고문헌 (16)
Cassady JP, Johnson R, Pomp D, Rohrer G, Van Vleck LD, Spiegel E, Gilson K. 2001. Identification of quantitative trait loci affecting reproduction in pigs. Journal of Animal Science 79:623-633.
Diniz D, Lopes M, Broekhuijse M, Lopes P, Harlizius B, Guimaraes S, Duijvesteijn N, Knol E, Silva F. 2014. A genome-wide association study reveals a novel candidate gene for sperm motility in pigs. Animal Reproduction Science 151:201-207.
Frungieri MB, Gonzalez-Calvar SI, Parborell F, Albrecht M, Mayerhofer A, Calandra RS. 2006. Cyclooxygenase-2 and prostaglandin F2 ${\alpha}$ in Syrian hamster Leydig cells: inhibitory role on luteinizing hormone/human chorionic gonadotropinstimulated testosterone production. Endocrinology 147:4476-4485.
Gunawan A, Cinar M, Uddin M, Kaewmala K, Tesfaye D, Phatsara C, Tholen E, Looft C, Schellander K. 2012. Investigation on association and expression of ESR2 as a candidate gene for boar sperm quality and fertility. Reproduction in Domestic Animals 47:782-790.
Heytens E, Parrington J, Coward K, Young C, Lambrecht S, Yoon S-Y, Fissore R, Hamer R, Deane C, Ruas M. 2009. Reduced amounts and abnormal forms of phospholipase C zeta ( $PLC{\zeta}$ ) in spermatozoa from infertile men. Human Reproduction 24:2417-2428.
Kaewmala K, Uddin M, Cinar M, Grosse Brinkhaus C, Jonas E, Tesfaye D, Phatsara C, Tholen E, Looft C, Schellander K. 2011. Investigation into Association and Expression of PLCz and COX 2 as Candidate Genes for Boar Sperm Quality and Fertility. Reproduction in Domestic Animals 47:213-223.
Kurokawa M, Sato K-i, Wu H, He C, Malcuit C, Black SJ, Fukami K, Fissore RA. 2005. Functional, biochemical, and chromatographic characterization of the complete [Ca 2+] i oscillation-inducing activity of porcine sperm. Developmental Biology 285:376-392.
Maes D, Nauwynck H, Rijsselaere T, Mateusen B, Vyt P, de Kruif A, Van Soom A. 2008. Diseases in swine transmitted by artificial insemination: an overview. Theriogenology 70:1337-1345.
Ren D, Ren J, Xing Y, Guo Y, Wu Y, Yang G, Mao H, Huang L-S. 2009. A genome scan for quantitative trait loci affecting male reproductive traits in a White Duroc $\times$ Chinese Erhualian resource population. Journal of Animal Science 87:17-23.
Saunders CM, Larman MG, Parrington J, Cox LJ, Royse J, Blayney LM, Swann K, Lai FA. 2002. $PLC{\zeta}$ : a sperm-specific trigger of Ca2+ oscillations in eggs and embryo development. Development 129:3533-3544.
Sirianni R, Chimento A, De Luca A, Zolea F, Carpino A, Rago V, Maggiolini M, Ando S, Pezzi V. 2009. Inhibition of cyclooxygenase-2 down-regulates aromatase activity and decreases proliferation of Leydig tumor cells. Journal of Biological Chemistry 284:28905-28916.
Walter F. 2003. Medical Physiology: A Cellular and Molecular Approach. Elsevier, Saunders 108.
Yamaguchi K, Ishikawa T, Kondo Y, Fujisawa M. 2008. Cisplatin regulates Sertoli cell expression of transferrin and interleukins. Molecular and Cellular Endocrinology 283:68-75.
AI-Helper
※ AI-Helper는 부적절한 답변을 할 수 있습니다.