[논문]Inhibition of Metarhizium anisopliae infection of Protaetia brevitarsis seluensis larvae using several effective microorganisms

Kwak, Kyu-Won; Kwon, Soon Woo; Nam, Sung-Hee; Park, Kwan-Ho; Kim, Eun-Sun; Lee, Hee-Sam; Choi, Ji-Young; Han, Myung-Sae

doi:10.7852/ijie.2018.36.1.1

Inhibition of Metarhizium anisopliae infection of Protaetia brevitarsis seluensis larvae using several effective microorganisms 원문보기

International journal of industrial entomology, v.36 no.1, 2018년, pp.1 - 9

Kwak, Kyu-Won (National Institute of Agricultural Science, Department of Agricultural Biology) , Kwon, Soon Woo (National Institute of Agricultural Science, Department of Agricultural Biology) , Nam, Sung-Hee (National Institute of Agricultural Science, Department of Agricultural Biology) , Park, Kwan-Ho (National Institute of Agricultural Science, Department of Agricultural Biology) , Kim, Eun-Sun (National Institute of Agricultural Science, Department of Agricultural Biology) , Lee, Hee-Sam (National Institute of Agricultural Science, Department of Agricultural Biology) , Choi, Ji-Young (National Institute of Agricultural Science, Department of Agricultural Biology) , Han, Myung-Sae (Kyungpook National University, Department of Bio-fibers and Materials Science)

Abstract ▼ AI-Helper

The purpose of this study was to determine the best method for minimizing the occurrence of Metarhizium anisopliae infection of Protaetia brevitarsis seluensis during mass breeding on agricultural farms. There is a high demand for the use of P. b. seluensis larvae in animal feed and as food for humans. However, mass breeding results in the entomopathogenic fungal (usually M. anisopliae) infection of P. b. seluensis. A mixture of microorganisms (Bacillus subtilis, Lactobacillus plantarum, and Saccharomyces cerevisiae) delayed fungal infection by M. anisopliae, which infected fewer P. b. seluensis when the microorganism mixture was added to sawdust as feed for P. b. seluensis. When sawdust with the effective microorganisms (EM) was given to P. b. seluensis for 30 d, their mortality rate was approximately 35 % less than that of the control group, which was fed sawdust without the EM. In addition, the growth of M. anisopliae on agar media spread with each bacterium as inhibited by up to 80 % more than those spread with 4 % sodium hypochlorite, which is a harmless fungal inhibitor generally used in agricultural farms for disinfection.

주제어

표/그림 (5)

그림 Fig. 1. Metarhizium anisopliae infection of Protaetia brevitarsissleuensis at a farm in Korea.P. b. seluensis that died from M. anisopliae infection at P. b. seulensisfarms in Wanju and Cheongju, Korea, show dark green fungicovering their whole bodies.
그림 Fig. 2. Comparison of Protaetia brevitarsis seluensis mortality betweenEM treatment and control groups in Metarhizium anisopliae sawdust.The mortality rate of the third instar P. b. seluensis larvaeunder both the sealed and ventiliated conditions was 100%after 30 days, but the mortality rate of the EM group was 23.3%.(Con. Ven.: Control ventilation condition, Con. Seal.: Control sealedcondition, A. seal.: Effective microorganism composite, sealed condition)(t-test: *** P < 0.001)
그림 Fig. 3. Measurement of the growth inhibition zone and rate (%)against Metarhizium anisopliae for each EM. (A) In Sabourauddextrose agar medium, 200 μL of triple distilled water as a negativecontrol and 4 % sodium hypochlorite as a positive control wereevenly smeared using a sterilized glass rod before seeding M.anisopliae. A sample of 200 μL of Lactobacillus plantarum, Bacillussubtilis, and Saccharomyces cerevisiae were spread onto individual
그림 Fig. 4. Measurement of mortality rate when EM was injected intoProtaetia brevitarsis seluensis by hemolymphatic injection.Mortality rate was examined when each EM was injected into third
그림 Fig. 5. SEM of Metarhizium anisopliae treated the specificconcentrations of lactic acid The morphology of M. anisopliaeon SEM appeared not to be conidia but rather mycelia, andfungal sexual reproduction decreased. The size of sporesincreased and the mycelium became denser when treated lacticacid concentration to M. anisopliae was lower. This indicatedfungal conidial production was affected by specifc concentrationof lactic acid.

AI 본문요약
AI-Helper

* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.

제안 방법

Usually, insect farms use 4 % diluted sodium hypochlorite to prevent fungal contamination, and so it was used as the positive control in this study. The inhibitory effects of the EM against M. anisopliae were compared with that of the positive control and each experiment was replicated three times. The plates were checked for inhibition zones against M.
To identify the cultured fungi, genomic DNA was purified using a power soil DNA preparation kit (MO BIO, USA) and a polymerase chain reaction was performed on the prepared template DNA using ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC), or ITS1(TCCGTAGG TGAACCTGCGG) and LR3 (GTCTTGAAACACGGACC) as universal primers and an AccuPower PCR premix kit (Bioneer, Korea). The amplified polymerase chain reaction product was electrophoresed in 1 % agarose gel and purified using a QIAquick gel extraction kit (Qiagen, USA).
6 at OD 600 nm, 1 mL) broth was spread evenly on the agar medium. Using a sterile steel borer, 5 mm wells of M. anisopliae were punched in the center of each EM smeared plate, and the antifungal activities of each EM were examined. Usually, insect farms use 4 % diluted sodium hypochlorite to prevent fungal contamination, and so it was used as the positive control in this study.

대상 데이터

M. anisopliae (KACC 40969), B. subtilis (KACC 17047), L. plantarum (KACC 10552), and S. cerevisiae (KACC 30068) were obtained from the Korean Agricultural Culture Collection (KACC), Rural Development Administration (RDA), Wanju, Korea. B.
After spraying with water and mixing thoroughly, the sawdust was fermented for 30 d until gas was no longer produced. The fermented sawdust was purchased from the Smurf Bugs farm in Namyang-ju, Gyeonggi-do, Korea.
seluensis larvae, the antifungal effects of an effective microorganisms (EM) liquid mixture with three beneficial microorganisms, B. subtilis, L. plantarum, and S. cerevisiae, was tested.

데이터처리

A student’s t-test was used to assess the statistical differences among each group.

이론/모형

Antagonistic activity was measured using the agar ×well diffusion assay method developed by Grover and Moore (1962).

성능/효과

Our results (Fig. 4) showed that when each culture medium or microorganism was injected at a volume of 50 µL, the mortality rate increased by 10, 3, 20, and 3.3 % for the control, nutrient, MRS, and R2A broths, respectively, and 6.7, 23.3, and 10 % for L. plantarum (1 × 107 cfu mL-1), B.subtilis (1 × 107 cfu mL-1), and S. cerevisiae (1 × 107 cfu mL-1), respectively.
The measurement of the growth inhibition zone and rate (%) against M. anisopliae by each EM (Fig. 2) showed that all three EM exhibited a significantly larger inhibition than the negative or positive controls (** P < 0.01).
The amplified polymerase chain reaction product was electrophoresed in 1 % agarose gel and purified using a QIAquick gel extraction kit (Qiagen, USA). The purified DNA was sequenced at Macrogen Co., Korea and a BLAST search confirmed that it was 99.9 % identical to that of M. anisopliae (JQ861946, JX110371, Gu06673, and Gu066730).

참고문헌 (26)

Blagojev N, Skrinjar M, Veskovic-Moracanin S, Soso V (2012) Control of mould growth and mycotoxin production by lactic acid bacteria metabolites. Roman. Biotechnol Lett 17, 7219-7226.
Chernaki-Leffer AM, Sosa-Gomez DR, Almeida LM (2007) Selection for entomopathogenic fungi and LD50 of Metarhizium anisopliae (Metsch.) Sorok. for the lesser mealworm Alphitobius diaperinus (Panzer) (Coleoptera: Tenebrionidae). Revista Brasileira de Ciencia Avicola 9, 187-191.

상세보기
Dal Bello F, Clarke CI, Ryan LAM, Ulmer H, Schober TJ, Strom K et al. (2007) Improvement of the quality and shelf life of wheat bread by fermentation with the antifungal strain Lactobacillus plantarum FST 1.7. J Cereal Sci 45, 309-318.

상세보기
Grover RK, Moore JD (1962) Toximetric studies of fungicides against brown rot organisms, sclerotina-fructicola and S-laxa. Phytopathology 52, 876-880.
Kang M, Kang C, Lee H, Kim E, Kim J, Kwon, O et al. (2011) Effects of fermented aloe vera mixed diet on larval growth of Protaetia brevitarsis seulensis and protective effects of its extract against CCl4-induced hepatotoxicity in Sprague-Dawley rats. Entomol Res 42, 275-299.
Kim C, Lee J, Kim B, Lee M, Kang K, Joo W (2013) The optimal condition and enzyme activity of entomopathogenic fungus Beauveria bassiana using extracted rice bran. J Life Sci 23, 1010-1018.

원문보기 상세보기
Kim HG, Park K, Lee S, Kwak K, Choi J. (2015) Effects of different diets and temperatures on larval growth of the white-spotted flower chafer, Protaetia brevitarsis (Kolbe) (Coleoptera: Scarabaeidae). Int J Indust Entomol 31, 75-78.

원문보기 상세보기
Kluge B, Vater J, Salnikow J, Eckart K (1988) Studies on the biosynthesis of surfactin, a lipopeptide antibiotic from Bacillus subtilis ATCC 21332. FEBS Lett 231, 107-110.

상세보기
Kwak K, Nam S, Choi J, Lee S, Kim H, Kim S et al. (2015) Simultaneous detection of fungal, bacterial, and viral pathogens in insects by multiplex PCR and capillary electrophoresis. Int J Indust Entomol 30, 64-74.

원문보기 상세보기
Kwak K, Han M, Nam S, Park K, Kim E, Lee S, Choi J et al (2016) Effect of Saccharomyces cerevisiae consumption on the pathogenicity of Beauveria bassiana in Protaetia brevitarsis. Int J Indust Entomol 33(1), 1-5.

원문보기 상세보기
Kwon H, Bang K, Cho S (2014) Characterization of the hemocytes in larvae of Protaetia brevitarsis seulensis: involvement of granulocyte-mediated phagocytosis. PloS One 9(8), 1-12.
Li J, Yang Q, Zhao L, Wang Y (2008) Antifungal substance from biocontrol Bacillus subtilis B29 strain. China Biotechnol 28, 59-65 (in Chinese).
Majumdar SK, Bose SK (1958) Mycobacillin, a new antifungal antibiotic produced by B. subtilis. Nature 181, 134-135.

상세보기
Moyne AL, Cleveland TE, Tuzun S (2004) Molecular characterization and analysis of operon encoding the antifungal lipopeptide bacillomycin D. FEMS Microbiol Lett 234, 43-49.

상세보기
Pandey DK, Tripathi NN, Tripathi RO, Dixit SN (1982) Fungitoxic and phytotoxic properties of essential oil of Phylis sauvolensis. Pfkrankh. Pfschuz 89, 334-346.
Pendland JC, Boucias DG (1998) Characterization of monoclonal antibodies against cell wall epitopes of the insect pathogenic fungus, Nomuraea rileyi: differential binding to fungal surfaces and cross-reactivity with host hemocytes and basement membrane components. Euro J C biol 75, 118-127.

상세보기
Peypoux F, Pommier MT, Marion D, Ptak M, Das BC, Michel G (1986) Revised structure of mycosubtilin, a peptidolipid antibiotic from Bacillus subtilis. J Antibiotics 39, 636-641.
Shetty PH, Jespersen L (2006) Saccharomyces cerevisiae and lactic acid bacteria as potential mycotoxin decontaminating agents. Trends Food Sci Technol 17, 48-55.

상세보기
Silman RW, Nelson TC, Bothast RJ (1991) Comparison of culture methods for production of Collectotrichum truncatum spore for use as a mycoherbicide. FEMS Microbiol Lett 78(1), 69-74.
Strom K, Sjogren J, Broberg A, Schnurer J (2002) Lactobacillus plantarum MiLAB 393 produces the antifungal cyclic dipeptides cyclo (L-Phe-L-Pro) and cyclo (L-Phe-trans-4-OH-L-Pro) and 3-phenyllactic acid. Appl Environ Microbiol 68, 4322-4327.

상세보기
Tebbets B, Yu Z, Stewart D, Zhao LX, Jiang Y, Xu LH et al. (2013) Identification of antifungal natural products via Saccharomyces cerevisiae bioassay: insights into macrotetrolide drug spectrum, potency and mode of action. Med Mycol 51, 280-289.

상세보기
Teixeira ML, Dalla Rosa A, Brandelli A (2013) Characterization of an antimicrobial peptide produced by Bacillus subtilis subsp. spizezinii showing inhibitory activity towards Haemophilus parasuis. Microbiol 159, 980-988.

상세보기
Van Huis A, Van Itterbeeck J, Klunder H, Mertens E, Halloran A, Muir G et al. (2013) Edible insects: future prospects for food and feed security. Food and Agriculture Organization of the United Nations (FAO), Rome.
Yoo YC, Shin BH, Hong JH, Lee J, Chee HY, Song KS et al. (2007) Isolation of fatty acids with anticancer activity from Protaetia brevitarsis Larva. Arch Pharm Res 30, 361-365.

원문보기 상세보기
Zimmermann G (2007) Review on safety of the entomopathogenic fungus Metarhizium anisopliae. Biocon Sci Technol 17, 879-920

상세보기
Zars T (2003) Hot and cold in Drosophila larvae, Trends Neurosci 26, 575-577

상세보기

저자의 다른 논문 :

LOADING...

표제어: PCR

동의어: Packet Collision Rate

용어 설명 출처 목록 (6)

용어 설명: PCR은 세균 특이성이 있는 primer를 이용하여 적은 수의 세균이 있을지라도 쉽게 검출할 수 있는 유용한 방법이며, 이를 이용하여 구강 내 치면세균막이나 타액에서 직접 세균을 검출할 수 있게 되었다[8].

내보내기 구분	파일저장 인쇄 메일전송
구성항목	기본정보 상세정보 관리번호, 논문명, 저널/프로시딩명, 저자 , 발행년, 권, 호, 시작페이지, 끝페이지, 발행기관 관리번호, 논문명, 대등논문명, 저자 , 저널/프로시딩명, 발행기관, 발행년, 발행언어, 권, 호, 시작페이지, 끝페이지, ISBN, ISSN, 주제분야, 키워드, 초록(한글), 초록(영문), 저자(소속기관)
저장형식	Text(ASCII format) Excel format RefWorks Direct Export RIS format (for Reference Manager, ProCite, EndNote), Scholar's Aids, Mendeley
메일정보	받는사람 (필수) @ 보내는사람 (선택) @ 제목 내용 KISTI 검색결과 이메일 서비스
안내	총 건의 자료가 검색되었습니다. 다운받으실 자료의 인덱스를 입력하세요. (1-10,000) 검색결과의 순서대로 최대 10,000건 까지 다운로드가 가능합니다. 데이타가 많을 경우 속도가 느려질 수 있습니다.(최대 2~3분 소요) 다운로드 파일은 UTF-8 형태로 저장됩니다. 파일의 내용이 제대로 보이지 않을실 때는 웹브라우저 상단의 보기 -> 인코딩 -> 자동선택 여부를 확인하십시오. ~ Text(ASCII format) Excel format

연합인증