[논문]Cellulosimicrobium sp. YB-43으로부터 mannanase C 유전자의 클로닝과 효소 특성

윤기홍

doi:10.7845/kjm.2018.8019

[국내논문] Cellulosimicrobium sp. YB-43으로부터 mannanase C 유전자의 클로닝과 효소 특성
Gene cloning of β-mannanase C from Cellulosimicrobium sp. YB-43 and characterization of the enzyme 원문보기

Korean journal of microbiology = 미생물학회지, v.54 no.2, 2018년, pp.126 - 135

초록
AI-Helper

여러 종류의 mannanase를 생산하는 Cellulosimicrobium sp. YB-43으로부터 mannanase B를 암호하는 manB 유전자와 효소의 특성이 보고된 바 있다. Mannanase C (ManC)로 명명한 효소의 유전자가 manB 유전자의 하류에 위치한 것으로 예상되어 이를 중합효소 연쇄반응으로 클로닝하여 manC 유전자의 염기서열을 결정하였다. ManC는 448 아미노산 잔기로 구성된 것으로 확인되었으며 glycosyl hydrolase family 5에 속하는 mannanase와 상동성이 높은 활성영역과 탄수화물 결합영역(CBM2)이 존재하였다. ManC의 활성영역은 Streptomyces sp. SirexAA-E (55.8%; 4FK9_A) 및 S. thermoluteus (57.6%; BAM62868)의 mannanase와 아미노산 배열의 상동성이 55% 이상으로 가장 높았다. Signal peptide 영역이 제거되고 카르복실 말단에 hexahistidine이 연결되도록 제조한 His-tagged ManC (HtManC)의 유전자를 재조합 대장균에서 발현하여 균체 파쇄액으로부터 HtManC를 정제하였다. HtManC은 $65^{\circ}C$와 pH 7.5에서 최대 활성을 보였으며 pH 7.5~10범위에서 활성에 큰 변화가 없었다. HtManC는 locust bean gum (LBG)과 konjac에 대한 분해 활성이 guar gum과 ivory nut mannan (ivory nut)에 비해 높았다. 최적 반응조건에서 LBG를 기질로 하여 반응 동력학적 계수를 측정한 결과 Vmax와 Km이 68 U/mg과 0.45 mg/ml로 나타났다. HtManC에 의한 만노올리고당(MOS)과 mannan의 분해산물을 TLC로 관찰한 결과 mannobiose 보다 중합도가 큰MOS로부터 mannobiose와 mannotriose가 주된 분해산물로 생성되었다. 또한 LBG, konjac과 ivory nut의 분해산물로 mannobiose와 소량이 mannose가 공통적으로 관찰되었다.

Abstract ▼ AI-Helper

The characteristics of enzyme and gene for mannanase B had been reported from Cellulosimicrobium sp. YB-43 producing some kind of mannanase. A gene coding for the enzyme, named mannanase C (ManC), was expected to be located downstream of the manB gene. The manC gene was cloned by polymerase chain reaction and sequenced completely. From this nucleotide sequence, ManC was identified to consist of 448 amino residues and contain a carbohydrate binding domain CBM2 besides a catalytic domain, which was homologous to mannanase belonging to the glycosyl hydrolase family 5. The catalytic domain of ManC showed the highest amino acid sequence similarity of 55% with the mannanases from Streptomyces sp. SirexAA-E (55.8%; 4FK9_A) and S. thermoluteus (57.6%; BAM62868). The His-tagged ManC (HtManC) lacking N-terminal signal peptide with hexahistidine at C-terminus was produced and purified from cell extract of recombinant Escherichia coli. The purified HtManC showed maximal activity at $65^{\circ}C$ and pH 7.5, with no significant change in its activity at pH range from 7.5 to 10. HtManC showed more active on konjac and locust bean gum (LBG) than guar gum and ivory nut mannan (ivory nut). Vmax and Km values of the HtManC for LBG were 68 U/mg and 0.45 mg/ml on the optimal condition, respectively. Mannobiose and mannotriose were observed on TLC as major products resulting from the HtManC hydrolysis of mannooligosacharides. In addition, mannobiose and mannose were commonly detected as the hydrolyzed products of LBG, konjac and ivory nut.

Keyword

AI 본문요약
AI-Helper

문제 정의

, 2011a;Yoon, 2015). Cellulosimicrobium sp. YB-43의 mannanase 중에서 mannanase B (ManB)의 유전자는 클로닝되고 효소 특성이 밝혀진 바 있으며(Yoon, 2016), 본 연구에서는 이와는 다른 mannanase C (ManC)의 유전자를 클로닝하여 재조합 대장균으로부터 효소를 정제하고 그 특성을 조사하였다.

제안 방법

Cellulosimicrobium sp. YB-43의 manB 유전자 주변 염기서열(GenBank accession no. KX620013)과 Cellulosimicrobiumsp. MM의 유전체 염기서열(NZ_JPQW01000295)을 참고하여 mannanase 유전자로 예상되는 DNA 단편을 증폭하기 위한 primer PCM2-3F (CATGAAGCGGTTCATTTGGGAGT)와 PCM2-3R (CTCACGCTCGACAAGGCGCTCTA)을 설계하였다. Cellulosimicrobium sp.
manC 유전자를 재조합 대장균에서 과잉발현 하기 위해 signal peptide 영역에 해당하는 부분을 제거한 유전자를 pET23a의 T7 promoter 하단에 도입하였으며, 이와 동시에 효소의 정제과정을 간편화하기 위해 종결코돈을 제거하고 카르복시 말단에 His tag이 융합되도록 하였다. 이렇게 제조된 재조합 플라스미드 pCME3을 E.

성능/효과

이를 대장균에 형질전환하여 LBG 분해활성을 갖는 형질전환주를 얻었다. 형질전환주로부터 추출한 재조합 플라스미드에 삽입된 단편의 염기서열을 결정한 결과 PCR로 증폭 단편을 사용하여 결정된 염기서열과 동일하여 클로닝된 manC 유전자는 PCR 증폭과정 중 변이가 없었음이 확인되었다.
본 연구를 통해 밝혀진ManC의 아미노산 배열은 기능이 보고된 기존의 mannanase와 상동성이 50% 미만의 수준으로 낮았다. 또한 재조합 대장균에서 생산된 HtManC의 반응 특성과 안정성 및 가수분해 산물을 비교하였을 때 HtManC는 YB-43의 배양상등액으로부터 정제된 ManC와 유사한 것으로 확인되었고 YB-43의 또 다른 mannanase인 ManB와는 차이가 있었으며, 아미노 말단의 서열이 유사한 C.
본 연구를 통해 밝혀진ManC의 아미노산 배열은 기능이 보고된 기존의 mannanase와 상동성이 50% 미만의 수준으로 낮았다. 또한 재조합 대장균에서 생산된 HtManC의 반응 특성과 안정성 및 가수분해 산물을 비교하였을 때 HtManC는 YB-43의 배양상등액으로부터 정제된 ManC와 유사한 것으로 확인되었고 YB-43의 또 다른 mannanase인 ManB와는 차이가 있었으며, 아미노 말단의 서열이 유사한 C. funkei HY-13의 ManK와는 반응특성의 유사성이 높지 않은 것으로 밝혀졌다.

질의응답

핵심어	질문	논문에서 추출한 답변
	Mannanase의 구조적 특징은 무엇인가?	Mannanase는 cellulase나 xylanase와 유사하게 활성영역으로만 구성되거나 또는 추가적으로 탄수화물 결합영역(cellulose binding domain; CBM), S-layer-homologous (SLH)이나 fibronectin(FN) 영역을 포함하고 있다(Kumagai et al., 2011; Takasuka etal.
	HtManC의 활성이 SDS에 의해 증가된 까닭으로 추정되는 것은 무엇인가?	2배 활성이 증가하여 HtManC 보다 높은 증가율을 보였다(Ferreira and Filho, 2004). 한편 SDS는 단백질 형태를 변화시켜 대부분의 효소에서 활성을 감소시키는 효과를 보이지만, 일부의 효소는 일정한 농도의 SDS가 존재해도 단백질의 2차 구조가 변화하지 않고 외부 표면에 결합된 SDS에 의해 단백질 형태에 제한적으로 미세한 변화가 일어남으로써 효소 활성이 증가하는 것으로 밝혀졌다(Moore and Flurkey, 1990). HtManC의 활성이 SDS에 의해 증가된 것도 이러한 현상과 관련이 있을 것으로 추정된다.
	Mannanase는 어떤 효소인가?	Mannanase는 β-mannan, glucomannan, galactomannan과galactoglucomannan으로 분류된 mannan 다당류를 구성하는 mannose 잔기간 β-1,4-mannosyl 결합을 무작위적으로 분해하는 효소로 β-mannosidase, α-galactosidase, β-glucosidase 및 acetyl mannan esterase와 함께 mannan의 분해에 관여하며 이들 효소 중 가장 주된 역할을 한다. 미생물뿐 아니라 동물과 식물에서도 생산되는 것으로 알려진 mannanase는 섬유물질의 가수분해에 관여하는 효소 중 cellulase와 xylanase에 비해 뒤 늦게 관심을 받았으며 1990년대 이후부터 그 특성이 다양한 미생물 유래의 효소를 중심으로 본격적인 연구가 이루어졌다.

참고문헌 (26)

Arcand, N., Kluepfel, D., Paradis, F.W., Morosoli, R., and Shareck, F. 1993. $\beta$ -Mannanase of Streptomyces lividans 66: cloning and DNA sequence of the manA gene and characterization of the enzyme. Biochem. J. 290, 857-863.

상세보기
Dhawan, S. and Kaur, J. 2007. Microbial mannanases: an overview of production and applications. Crit. Res. Biotechnol. 27, 197-216.

상세보기
Ferreira, H.M. and Filho, E.X.F. 2004. Purification and characterization of a $\beta$ -mannanase from Trichoderma harzianum strain T4. Carbohydr. Polym. 57, 23-29.

상세보기
Hilge, M., Gloor, S.M., Rypniewski, W., Sauer, O., Heightman, T.D., Zimmermann, W., Winterhalter, K., and Piontek, K. 1998. High-resolution native and complex structures of thermostable $\beta$ -mannanase from Thermomonospora fusca - substrate specificity in glycosyl hydrolase family 5. Structure 6, 1433-1444.

상세보기
Kim, D.Y., Ham, S.J., Lee, H.J., Cho, H.Y., Kim, J.H., Kim, Y.J., Shin, D.H., Rhee, Y.H., Son, K.H., and Park, H.Y. 2011a. Cloning and characterization of a modular GH5 $\beta$ -1,4-mannanase with high specific activity from the fibrolytic bacterium Cellulosimicrobium sp. strain HY-13. Bioresour. Technol. 102, 9185-9192.

상세보기
Kim, D.Y., Ham, S.J., Lee, H.J., Kim, Y.J., Shin, D.H., Rhee, Y.H., Son, K.H., and Park, H.Y. 2011b. A highly active endo- $\beta$ -1,4-mannanase produced by Cellulosimicrobium sp. strain HY-13, a hemicellulolytic bacterium in the gut of Eisenia fetida. Enzyme Microb. Technol. 48, 365-370.

상세보기
Kumagai, Y., Kawakami, K., Mukaihara, T., Kimura, M., and Hatanaka, T. 2012. The structural analysis and the role of calcium binding site for thermal stability in mannanase. Biochimie 94, 2783-2790.

상세보기
Kumagai, Y., Kawakami, K., Uraji, M., and Hatanaka, T. 2013a. Binding of bivalent ions to actinomycete mannanase is accompanied by conformational change and is a key factor in its thermal stability. Biochim. Biophys. Acta 1834, 301-307.

상세보기
Kumagai, Y., Kawakami, K., Uraji, M., and Hatanaka, T. 2013b. Effect of the binding of bivalent ion to the calcium-binding site responsible for the thermal stability of actinomycete mannanase: Potential use in production of functional mannooligosaccharides. J. Mol. Cataly. B: Enzym. 94, 63-68.

상세보기
Kumagai, Y., Usuki, H., Yamamoto, Y., Yamasato, A., Arima, J., Mukaihara, T., and Hatanaka, T. 2011. Characterization of calcium ion sensitive region for $\beta$ -mannanase from Streptomyces thermolilacinus. Biochim. Biophys. Acta 1814, 1127-1133.

상세보기
Kweun, M.A., Lee, M.S., Choi, J.H., Cho, K.H., and Yoon, K.H. 2004. Cloning of a Bacillus subtilis WL-7 mannanase gene and characterization of the gene product. J. Microbiol. Biotechnol. 14, 1295-1302.

원문보기 상세보기
Moore, B.M. and Flurkey, W.H. 1990. Sodium dodecyl sulfate activation of a plant polyphenoloxidase. Effect of sodium dodecyl sulfate on enzymatic and physical characteristics of purified broad bean polyphenoloxidase. J. Biol. Chem. 265, 4982-4988.
Oda, M., Inaba, S., Kamiya, N., Bekker, G.J., and Mikami, B. 2018. Structural and thermodynamic characterization of endo-1,3- $\beta$ -glucanase: Insights into the substrate recognition mechanism. Biochim. Biophys. Acta 1866, 415-425.

상세보기
Pradeep, G.C., Cho, S.S., Choi, Y.H., Choi, Y.S., Jee, J.P., Seong, C.N., and Yoo, J.C. 2016. An extremely alkaline mannanase from Streptomyces sp. CS428 hydrolyzes galactomannan producing series of mannooligosaccharides. World J. Microbiol. Biotechnol. 32, 84.

상세보기
Schumann, P., Weiss, N., and Stackebrandt, E. 2001. Reclassification of Cellulomonas cellulans (Stackebrandt and Keddie 1986) as Cellulosimicrobium cellulans gen. nov., comb. nov. Int. J. Syst. Evol. Microbiol. 51, 1007-1010.

상세보기
Shi, P., Yuan, T., Zhao, J., Huang, H., Luo, H., Meng, K., Wang, Y., and Yao, B. 2011. Genetic and biochemical characterization of a protease-resistant mesophilic $\beta$ -mannanase from Streptomyces sp. S27. J. Ind. Microbiol. Biotechnol. 38, 451-458.

상세보기
Srivastava, P.K. and Kapoor, M. 2017. Production, properties, and applications of endo- $\beta$ -mannanases. Biotechnol. Adv. 35, 1-19.

상세보기
Stoll, D., Stalbrand, H., and Warren, R.A. 1999. Mannan-degrading enzymes from Cellulomonas fimi. Appl. Environ. Microbiol. 65, 2598-2605.

상세보기
Takasuka, T.E., Acheson, J.F., Bianchetti, C.M., Prom, B.M., Bergeman, L.F., Book, A.J., Currie, C.R., and Fox, B.G. 2014. Biochemical properties and atomic resolution structure of a proteolytically processed beta-mannanase from cellulolytic Streptomyces sp. SirexAA-E. PLoS One 9, e94166.

상세보기
Tjalsma, H. and van Dijl, J.M. 2005. Proteomics-based consensus prediction of protein retention in a bacterial membrane. Proteomics 5, 4472-4482.

상세보기
Vijayalaxmi, S., Prakash, P., Jayalakshmi, S.K., Mulimani, V.H., and Sreeramulu, K. 2013. Production of extremely alkaliphilic, halotolerent, detergent, and thermostable mannanase by the free and immobilized cells of Bacillus halodurans PPKS-2. Purification and characterization. Appl. Biochem. Biotechnol. 171, 382-395.

상세보기
Walia, A., Mehta, P., Guleria, S., and Shirkot, C.K. 2015. Modification in the properties of paper by using cellulase-free xylanase produced from alkalophilic Cellulosimicrobium cellulans CKMX1 in biobleaching of wheat straw pulp. Can. J. Microbiol. 61, 671-681.

상세보기
Yoo, H.Y., Pradeep, G.C., Lee, S.K., Park, D.H., Cho, S.S., Choi, Y.H., Yoo, J.C., and Kim, S.W. 2015. Understanding $\beta$ -mannanase from Streptomyces sp. CS147 and its potential application in lignocellulose based biorefining. Biotechnol. J. 10, 1894-1902.

상세보기
Yoon, K.H. 2015. Characterization of two $\beta$ -mannanases from Cellulosimicrobium sp. YB-43. Korean J. Microbiol. 51, 263-270.

원문보기 상세보기
Yoon, K.H. 2016. Molecular cloning and characterization of $\beta$ -mannanase B from Cellulosimicrobium sp. YB-43. Korean J. Microbiol. 52, 336-343.

원문보기 상세보기
Zhang, J.X., Chen, Z.T., Meng, X.L., Mu, G.Y., Hu, W.B., Zhao, J., and Nie, G.X. 2017. Gene cloning, expression, and characterization of a novel $\beta$ -mannanase from the endophyte Paenibacillus sp. CH-3. Biotechnol. Appl. Biochem. 64, 471-481.

상세보기

저자의 다른 논문 :

활용도 분석정보

상세보기

다운로드

내보내기

활용도 Top5 논문

해당 논문의 주제분야에서 활용도가 높은 상위 5개 콘텐츠를 보여줍니다.
더보기 버튼을 클릭하시면 더 많은 관련자료를 살펴볼 수 있습니다.

표제어: PCR

동의어: Packet Collision Rate

용어 설명 출처 목록 (6)

용어 설명: PCR은 세균 특이성이 있는 primer를 이용하여 적은 수의 세균이 있을지라도 쉽게 검출할 수 있는 유용한 방법이며, 이를 이용하여 구강 내 치면세균막이나 타액에서 직접 세균을 검출할 수 있게 되었다[8].

내보내기 구분	파일저장 인쇄 메일전송
구성항목	기본정보 상세정보 관리번호, 논문명, 저널/프로시딩명, 저자 , 발행년, 권, 호, 시작페이지, 끝페이지, 발행기관 관리번호, 논문명, 대등논문명, 저자 , 저널/프로시딩명, 발행기관, 발행년, 발행언어, 권, 호, 시작페이지, 끝페이지, ISBN, ISSN, 주제분야, 키워드, 초록(한글), 초록(영문), 저자(소속기관)
저장형식	Text(ASCII format) Excel format RefWorks Direct Export RIS format (for Reference Manager, ProCite, EndNote), Scholar's Aids, Mendeley
메일정보	받는사람 (필수) @ 보내는사람 (선택) @ 제목 내용 KISTI 검색결과 이메일 서비스
안내	총 건의 자료가 검색되었습니다. 다운받으실 자료의 인덱스를 입력하세요. (1-10,000) 검색결과의 순서대로 최대 10,000건 까지 다운로드가 가능합니다. 데이타가 많을 경우 속도가 느려질 수 있습니다.(최대 2~3분 소요) 다운로드 파일은 UTF-8 형태로 저장됩니다. 파일의 내용이 제대로 보이지 않을실 때는 웹브라우저 상단의 보기 -> 인코딩 -> 자동선택 여부를 확인하십시오. ~ Text(ASCII format) Excel format

연합인증