[논문]마그놀롤의 HDF세포에서 Nrf2-SOCS3-Jak2-STAT3에 의한 UVB 유래 염증데미지 조절

남영선; 지주리

doi:10.5352/jls.2020.30.10.867

마그놀롤의 HDF세포에서 Nrf2-SOCS3-Jak2-STAT3에 의한 UVB 유래 염증데미지 조절
The Effect of Magnolol on UVB-induced Inflammation Damage Control via the Nrf2-SOCS3-Jak2-STAT3 Pathway in Human Dermal Fibroblasts 원문보기

생명과학회지 = Journal of life science, v.30 no.10, 2020년, pp.867 - 876

남영선 (신경대학교 뷰티디자인학과) , 지주리 (동남보건대학교 뷰티케어과)

초록
AI-Helper

본 연구는 magnolol에 의한 UVB 유도 세포 손상의 복구를 조사하였다. 우리는 약물재배치를 위해 STAT3 기작을 분석하였고, magnolol HDF 세포에서 세포 생존력을 향상시키며, STAT3의 억제제인 것을 확인하였다. IL-6, UVB 및 IFNγ로 처리 된 HDF 세포는 Jak2 및 인산화 된 STAT3 (p-STAT3)의 높은 발현을 나타냈다. Magnolol 의 처리는 UVB 유도 세포에서 Jak2 및 p-STAT3의 발현을 감소시킬 수 있었다. 또한, UVB- 손상된 세포 성장은 용량 의존적 방식으로 재 활성화 및 magnolol 과의 상관 관계가 상당히 증가되었다. UVB 처리 된 HDF 세포에 대한 AG490 (Jak2 억제제) 처리와 비교하여, 세포 증식이 유의하게 증가 하였다. 우리는 AG490 및 magnolol 이 TNF-α 농도를 감소시키는 것을 확인했다. Western blot (단백질 수준)은 오직 magnolol 처리 된 세포에서만 Jak2 및 p-STAT3 발현의 감소를 나타냈고, Jak2, p-STAT3 및 SOCS3의 발현은 또한 magnolol 처리한 세포에서만 증가하였다. 세포를 magnolol 및 ML385 (NRF2 억제제)로 동시 처리시 세포 증식 및 NRF2 발현을 감소시켰다. MMP9의 양은 magnolol 및 ML385 로의 처리에 의해 증가되었다. 종합적으로, 이들 결과는 NRF2, SOCS3, Jak2 및 STAT3의 발현을 조절함으로써 UVB 손상 후 세포를 회복시키는데 있어 magnolol의 가능성을 입증한다.

Abstract ▼ AI-Helper

This study investigated the repair of UVB-induced cell damage by magnolol. We performed a drug-repurposing screen, and, in the STAT3 reporter gene assay, magnolol was identified as a suppressor of STAT3 that improves the cell viability of HDF cells. HDF cells treated with IL-6, UVB, and IFNγ showed the highest expression of Jak2 and phosphorylated STAT3 (p-STAT3), and magnolol was able to decrease the expression of Jak2 and p-STAT3 in UVB-induced cells. Moreover, UVB-damaged cell growth increased significantly in correlation with both reactivation and with magnolol in a dose-dependent manner. Compared with AG490 (a Jak2 inhibitor) treatment of UVB-treated HDF cells, cell proliferation increased significantly. We confirmed that AG490 and magnolol reduced TNF-α concentrations, and Western blotting (protein level) showed decreases in Jak2 and p-STAT3 expression in only the magnolol-treated cells. The expression of Jak2, p-STAT3, and SOCS3 also increased only after treatment with magnolol. Cells were treated with magnolol and ML385 (an NRF2 inhibitor), and these secondary metabolites reduced cell proliferation and NRF2 expression. The amount of MMP9 was also increased by cotreatment with magnolol and ML385. Collectively, these results demonstrate the potential of magnolol for repairing cells after UVB-induced damage by regulating the expression of NRF2, SOCS3, Jak2, and STAT3.

주제어

표/그림 (6)

표 Table 1. Characteristic of single compound information
표 Table 1. Continued
그림 Fig. 1. Select of magnolol from STAT3 promoter inhibition and cell proliferation experiments of 80 natural-derived single substances in UVB-induced oxidation stress. UVB-induced oxidation stressed HDF cells were treated with different single compounds for 24 hr, and the relative Stat3 promoter inhibition (A) and high cell proliferation (B) was determined. The stat (★) was hit compound (mognolol). Data were expressed as mean (n=3).
그림 Fig. 2. Effect of magnolol on IL6, UV and IFNγ-induced inflamation stress control leads to cell viability in HDF cells. IL6 (A) 20 ng/ml, UBV (B) 600 mJ/Cm² and IFNγ (C) 20 ng/mL treated cell expression of Jak2-Stst3 protein. Cells were incubated with the magnolol for 24 hr, the Jak2-STAT3 expression (D), the cell viability (F) were compared to UBV 600 mJ/Cm² vs. 600 mJ/Cm² with magnolol. UVB-induced Jak2 and STAT3 mRNA expression level were change by magnolol (E), M. magnolol, **p<0.01 compared to control group.
그림 Fig. 3. Effect of magnolol on UVB-induced cell death pathway to overcome by TNFα and MMP9. UVB-induced cell viability and magnolol effect on HDF cells (A), AG490 (Jak2 inhibitor) 40 μM (B) 600 mJ/Cm² and IFNγ (C) 20 ng/ml treated cell expression of Jak2-Stst3 protein. Cells were incubated with the magnolol for 24 hr, the Jak2-STAT3 expression (D), the cell viability were compared to UBV 600 mJ/Cm² vs. 600 mJ/Cm² with magnolol. ##p<0.01, ###p<0.001 compared to control group. **p<0.01 , ***p<0.001 compared to control (+UVB) group.
그림 Fig. 4. Role of NRF2-SOCS3-JAK2-STAT3 control on UVB-induced HDF cells by magnolol. UVB (600 mJ/Cm²)-induced cell signaling of Jak2, STAT3 and SOCS3 in HDF cells (A), ML385 (NRF2 inhibitor) 3.5 μM treated cells. STAT3 mRNA expression level (B), Cell proliferation (C), Nrf2 luciferase activity (D) and MMP-9 expression level (E) is incubated with the magnolol or ML385 or magnolol with ML385 for 24 hr. Western blots of total cell lysates and nuclear extracts (F) and mechanism of Action/Pathway Profiles (G). #p<0.05, ###p<0.001 compared to control group. *p<0.05, **p<0.01, ***p<0.001 compared to control (+UVB) group.

AI 본문요약
AI-Helper

* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.

문제 정의

하지만, 피부의 자극 및 노화를 촉진하거나, 일부 염증을 유발시켜 심하게는 피부암을 유발하는 염증성 반응을 동반할 수 있다. 앞서 기술한 magnolol의 항산화, 항염증 및 피부세포의 재상을 조절하는 기전을 통해 새로운 연구의 기초를 제시하고자 한다.
그러나, magnolol의 항산화 기작 중 UVB 데미지 피부세포에 대한 매커니즘적 연구는 정확하게 알려져 있지 않다. 이에 본 연구에서는 magnolol의 처리가 피부세포에서 UVB에 저항하는 기작을 확인하였다.

제안 방법

60 mm plate (SPL Life Sciences, Seoul, Korea)에 5×105 세포수로 12시간 배양한 IL6 및 IFNγ는 magnolol을 5, 10, 20 μM로 처리 후 20 ng/ml처리 30분 뒤 세포를 수집하였고, UVB는 magnolol을 5, 10, 20 μM로 처리 후 Dulbecco’s phosphate buffered saline (DPBS, ThermoFisher Scientific, IL, USA)로 세척 후 serum 1% 첨가된 배지에서 UVB를 조사하였다.
3회 PBS-T로 세척한 뒤 2차 항체를 각각 1:5,000의 농도로 실온에서 처리 후 다시 3회 PBS-T로 세척하였다. Amersham ECL Western blotting detection reagent (GE Healthcare, Buckinghamshire, UK)를 이용하여 X-ray film (BioMax MR film, Kodak, USA) 발색으로 측정하였다. 항체는anti-Jak2, anti-p-STAT3, anti-STAT3, antiβ-actin (Santa Cruze, Dallas, TX, USA), anti-SOCS3 (Thermo Fisher Scientific Life Sciences, MA, USA)을 이용하였다.
NP-40 (Bio-rad, CA, USA)으로 균질화시켜 2분간 원심 분리하여 얻어진 상층액 및 Kit에 포함된 방법으로 각 well에 상층액을 20 μl씩 분주하여 섞은 후 30분간 실온에 방치하였다. ELISA 측정은Wallac Victor2 plate reader를 이용하여 optical density를 측정하였다.
추출된 RNA는 Power cDNA synthesis kit (iNtRON Biotechnology, Seongnam, Korea)을 이용하여 cDNA를 합성한 후 SYBR green과 각 primer를 이용하여 Corbett 6000 Rotor-Gene thermocycler(Corbett Life Science, Mortlake, Australia)을 이용하여 real-time PCR을 수행하고, 대조군 유전자로는 GAPDH를 사용하였다. GAPDH 발현 대비 target 유전자의 발현을 상대적으로 정량ㆍ분석하였다. Real-time PCR에 사용한 primer sequence는 GAPDH (Forward AATGGACAACTGGTCGTGG AC, Reverse CCCTCCAGGGGATCTGTTTG), Jak2 (Forward ATCCACCCAACCATGTCTTCC, Reverse ATTCCATGCCG ATAGGCTCTG), STAT3 (Forward ACCAGCAGTATAGCC GCTTC, Reverse GCCACAATCCGGGCAATCT)을 이용하였다.
HDF 세포주를 35 mm 세포배양 접시에 8×104 세포수로 12시간 배양한 뒤 세포를 DMSO, 10μM H2O2 (Sigma-Aldrich, MO, USA) 또는 병풀 추출물(20 μg/ml), 분획물(13 μg/ml) 및 asiaticoside (100 μM, Sigma-Aldrich, MO, USA)을 동시 처리 후 24시간 뒤 세포를 수집하였다.
HDF 세포주를 60 mm 세포배양 접시에 5×105 세포수로 12시간 배양한 뒤 magnolol을 5, 10, 20 μM로 처리하여 세포를 수집하였다.
HDF세포에서 핵 내에 있는 STAT3의 양을 측정하기 위해 세포질 및 핵을 분리하는 실험을 실시하였다. HDF세포주를 60 mm 세포배양 접시에 5×10⁵ 세포수로 12시간 배양한 뒤 magnolol을 5, 10, 20 μM를 처리한 후 세포를 수집하였다.
HDF세포주를 60 mm 세포배양 접시에 5×105 세포수로 12시간 배양한 뒤 magnolol을 5, 10, 20 μM로 처리하여 세포를 수집하였다.
HDF세포주를 60 mm 세포배양 접시에 5×105 세포수로 12시간 배양한 뒤 magnolol을 5, 10, 20 μM를 처리한 후 세포를 수집하였다.
GAPDH 발현 대비 target 유전자의 발현을 상대적으로 정량ㆍ분석하였다. Real-time PCR에 사용한 primer sequence는 GAPDH (Forward AATGGACAACTGGTCGTGG AC, Reverse CCCTCCAGGGGATCTGTTTG), Jak2 (Forward ATCCACCCAACCATGTCTTCC, Reverse ATTCCATGCCG ATAGGCTCTG), STAT3 (Forward ACCAGCAGTATAGCC GCTTC, Reverse GCCACAATCCGGGCAATCT)을 이용하였다.
세포계는 항산화 신호 전달을 전사적으로 제어하는 NFκB, AP1, HIF1α, P53, 및 Nrf2와 같은 몇몇 신호 전달 단백질 및 전사 인자의 활성화를 통해 산화를 억제한다[16]. 그러나, 세포에 따라 산화적 스트레스를 조절하는 여러 다른 조절 인자에 따라 크게 달라질 수 있기 때문에 UVB 데미지가 발생한 HDF 세포에서 항산화 기전인 Nrf2의 기능을 확인했다.
다시 하룻밤 배양한 뒤 UVB와 magnolol을 5, 10, 20 μM로 처리하였다.
또한, 선별된 magnolol은 5, 10, 20 μM로 처리하였다.
항산화 작용을 확인하기 위해 NRF2 binding site가 포함된 antioxidant response element (ARE) binding 부위를 pGL3 vector (Promega, USA)에 포함되도록 제작하여 실험을 실시하였다. 또한, 염증 작용을 확인하기 위해 STAT3 promoter가 포함된 pGL3 vector (Promega, USA)를 제작하여 실험을 실시하였다. STAT3 promoter는 80종의 천연물질을 선별에 이용하였다.
본 연구에서는 80개의 천연물유래 단일물질을 이용하여 HDF세포주에서 STAT3 promoter 실험과 세포 증식 실험을 확인하였다. 단일물질의 선별 기준은 120% 이상의 세포증식이 되면서, 80% 미만의 STAT3 promoter를 조절하는 기준점을 두었고, ★표시된 7번 물질인 magnolol이 선별되었다(Fig.
세포를 96 well plate (SPL Life Sciences, Seoul, Korea)에 1×104 세포수로 12시간 배양한 뒤 80종의 천연물질을 이용하여 세포 독성 또는 세포 증식을 확인하다.
UVB에 의해 발생되는 산화스트레스는 피부세포의 노화 및 콜라겐 분해 등과 같은 악영향을 미친다. 이에 magnolol 처리가 UVB의 산화 스트레스에 영향을 주는 지 확인하기 위해 Nrf2의 작용에 의해 발현되는 SOCS3를 확인하였고, magnolol 처리시 증가되는 것을 확인하였다. 또한, magnolol과 ML385 (Nrf2 억제제)를 같이 처리하였을 때 SOCS3가 억제되는 것을 확인하였다.
수집된 세포에 TRI reagent (Sigma-Aldrich, MO, USA)를 이용하여 total RNA를 분리한다. 추출된 RNA는 Power cDNA synthesis kit (iNtRON Biotechnology, Seongnam, Korea)을 이용하여 cDNA를 합성한 후 SYBR green과 각 primer를 이용하여 Corbett 6000 Rotor-Gene thermocycler(Corbett Life Science, Mortlake, Australia)을 이용하여 real-time PCR을 수행하고, 대조군 유전자로는 GAPDH를 사용하였다. GAPDH 발현 대비 target 유전자의 발현을 상대적으로 정량ㆍ분석하였다.
항산화 작용을 확인하기 위해 NRF2 binding site가 포함된 antioxidant response element (ARE) binding 부위를 pGL3 vector (Promega, USA)에 포함되도록 제작하여 실험을 실시하였다. 또한, 염증 작용을 확인하기 위해 STAT3 promoter가 포함된 pGL3 vector (Promega, USA)를 제작하여 실험을 실시하였다.
후박의 추출은 915 g의 후박건조물을 3일간 80% 메탄올 추출한 뒤 감압농축 하였고, 건조 추출분말(155 g)을 3차 증류수에 섞어 n-hexane (14.4 g), ethyl acetate (32.1 g), n-butanol(45.3 g) 및 water (22.8 g)을 얻어 농축 및 동결건조 후 실험에 이용하였다. 농축과정에서 생성된 거품층은 실험 중간 제거하였다.

대상 데이터

STAT3 promoter는 80종의 천연물질을 선별에 이용하였다. HDF 세포주를 4.5 g/l D-Glucose, L-Glutamine, 110 mg/l Sodium Pyruvate가 포함된 DMEM (well gene)과 10% FBS, 1% Penicillin streptomycin (GenDEPOT, Barker, TX, USA)에 배양하였으며, 37℃, 5% CO₂ 배양기 조건하에 배양하였다. 세포를 6-well plate (SPL Life Sciences, Seoul, Korea)에 3×10⁵ 세포수로 overnight 배양한 뒤 target vector와 pRL-Renilla vector를 1 μg 용량으로 Terbofect (Thermo Fisher Scientific, USA)시약으로 주입시켰다.
HDF세포주를 이용하여 세포의 독성테스트Cyto-X (LPS solution, Daejeon, Korea)시약을 이용하였다. 세포를 96 well plate (SPL Life Sciences, Seoul, Korea)에 1×10⁴ 세포수로 12시간 배양한 뒤 80종의 천연물질을 이용하여 세포 독성 또는 세포 증식을 확인하다.
Mognolol은 1 mg/ml의 농도로 에탄올에 녹인 후 dimethyl sulfoxide (DMSO, Sigma–Aldrich Corporation, MO, USA)로 희석하여 실험에 이용하였다. Human dermal fibroblast (ATCC, Manassas, VA, SCRC-1042)에서 분양 받아 Passage number 15의 조건에서 세포주를 실험에 이용하였다.
또한, 염증 작용을 확인하기 위해 STAT3 promoter가 포함된 pGL3 vector (Promega, USA)를 제작하여 실험을 실시하였다. STAT3 promoter는 80종의 천연물질을 선별에 이용하였다. HDF 세포주를 4.
UVB 램프(Heber Scientific lamp, 254-312 nm, Herber Scientific Company Ltd., Chennai, India)로 312 nm 35 mJ/cm2에 시간 단위로 노출하였고, 대조군는 형광등이 내제된 37℃, 5% CO2 배양기 조건하에 배양하였다.
본 연구에서는 80개의 천연물유래 단일물질을 이용하여 HDF세포주에서 STAT3 promoter 실험과 세포 증식 실험을 확인하였다. 단일물질의 선별 기준은 120% 이상의 세포증식이 되면서, 80% 미만의 STAT3 promoter를 조절하는 기준점을 두었고, ★표시된 7번 물질인 magnolol이 선별되었다(Fig. 1A, Fig. 1B).
선별된 후박의 성분으로 알려진 magnolol (분자량 266.33)을 Sigma-aldrich에서 HPLC 순도 95% 이상을 구매하여 실험에 이용하였다. Mognolol은 1 mg/ml의 농도로 에탄올에 녹인 후 dimethyl sulfoxide (DMSO, Sigma–Aldrich Corporation, MO, USA)로 희석하여 실험에 이용하였다.
항체는anti-Jak2, anti-p-STAT3, anti-STAT3, antiβ-actin (Santa Cruze, Dallas, TX, USA), anti-SOCS3 (Thermo Fisher Scientific Life Sciences, MA, USA)을 이용하였다.

데이터처리

모든 생리활성 실험은 3반복 실험을 통해 수치화 하였으며, 통계분석은 one-way ANOVA로 신뢰구간 p<0.05으로 검정을 실시하였다.
05으로 검정을 실시하였다. 통계프로그램은 Graph Pad Prism 5 software(Graph Pad Software, Inc., La Jolla, CA, USA)를 이용하였다.

이론/모형

배양 24시간 후 각 well의 세포를 회수하여 Dual-luciferase® reporter assay kit (Promega, USA)을 이용하여 제공된 실험방법에 따라 측정하였다.
최종적으로 13,000 rpm에서 5분간 원심분리를 시행하여 핵의 단백질로 이루어진 상층액을 얻었다. 분리된 상층액은 Bio-Rad protein assay 로 정량 후 Western blot을 실시하였다.
상층액을 회수하여 Bio-Rad protein assay (Bio-rad, CA, USA)를 이용하여 정량 후 10~25 μg의 단백질을 SDS-PAGE gel method를 이용하여 전기영동 하였다.
세포 내 TNF-α (BioVision, Milpitas, CA, USA) 및 MMP-9 (Merck, Darmstadt, Germany) 함량은 enzyme linked immunosorbent assay (ELISA) Kit을 이용하여 측정하였다.

성능/효과

AG490는 proMMP-9을 억제하는 것으로 알려져 있으며, 본 연구에서 MMP-9을 확인한 결과 AG490처리 모두 MMP-9을 억제하는 것을 확인하였다(p<0.001).
IL-6, UVB 및 IFNγ를 처리하여 HDF세포에서 Jak2-STAT3의 조절을 확인해 본 결과 모두 활성화되는 것을 확인하였다 (Fig. 2A, Fig. 2B, Fig. 2C).
MMP-9 역시 magnolol과 ML385를 동시 처리시 억제 감소되었지만 magnolol 단독 처리보다 MMP-9의 양이 증가된 것을 확인하였다(Fig. 4D, p<0.001).
SOCS3의 Jak2 조절의 매커니즘에서 ML385의 Jak2 억제와 magnolol의 SOCS3-Jak2억제와 비슷한 역할을 하는 것으로 판단되며[15, 26], MMP-9의 억제 작용은 SOCS3의 역할과 매우 관련성이 높은 것을 확인하였다. SOCS3와 관련된 보고에서 IL-6에 의해 SOCS3의 발현이 조절되는 것으로 알려져 있는데[9, 13], 본 연구에서는 UVB 유도 및 magnolol의 처리에서 SOCS3의 발현이 조절되는 것은 처음으로 확인하였다. HDF 세포에서 magnolol의 UVB 데미지 억제효과는 Nrf2-SOCS3의 활성화를 통한 Jak2-STAT3 억제를 보이며, SOCS3를 중심으로 세포, 생화학적, 분자 및 병리 생리 학적 수준에서 향후 SOCS3의 구체적 기전연구를 위한 기초자료로 활용할 수 있을 것이다.
SOCS3의 Jak2 조절의 매커니즘에서 ML385의 Jak2 억제와 magnolol의 SOCS3-Jak2억제와 비슷한 역할을 하는 것으로 판단되며[15, 26], MMP-9의 억제 작용은 SOCS3의 역할과 매우 관련성이 높은 것을 확인하였다. SOCS3와 관련된 보고에서 IL-6에 의해 SOCS3의 발현이 조절되는 것으로 알려져 있는데[9, 13], 본 연구에서는 UVB 유도 및 magnolol의 처리에서 SOCS3의 발현이 조절되는 것은 처음으로 확인하였다.
2E). UVB에 의해 유도된 세포독성이 세포의 성장을 억제하지만 magnolol의 처리가 세포의 성장을 유도하는 세포를 재생시키는 것을 확인하였다(Fig. 2F). 이 같은 결과는 염증성 사이토카인과 면역인터페론의 기전과 UVB의 염증 기전이 다른 것으로 보인다.
또한 magnolol 처리시 AG490과 유사하게 MMP-9을 억제하는 것을 확인하였다(p<0.001).
또한, AG490는 미세아교세포에서 TNF-α의 억제를 유도한 바 있기에[29], 본 연구에서도 UVB 처리시 유도된 대식세포에 의해 분비되는 염증성 사이토카인류인 TNF-α의 증가를 확인 하였고(p<0.001), magnolol 및 AG490 처리 모두 TNF-α를 억제하는 것을 확인하였다(p<0.001).
2D). 또한, UVB에 의해 조절되는 mRNA 발현양을 통해 UVB에 의해 증가되는 Jak2 및 STAT의 증가되는 양을 magnolol이 억제 조절하는 것을 알 수 있었다(Fig. 2E). UVB에 의해 유도된 세포독성이 세포의 성장을 억제하지만 magnolol의 처리가 세포의 성장을 유도하는 세포를 재생시키는 것을 확인하였다(Fig.
이에 magnolol 처리가 UVB의 산화 스트레스에 영향을 주는 지 확인하기 위해 Nrf2의 작용에 의해 발현되는 SOCS3를 확인하였고, magnolol 처리시 증가되는 것을 확인하였다. 또한, magnolol과 ML385 (Nrf2 억제제)를 같이 처리하였을 때 SOCS3가 억제되는 것을 확인하였다. 이 같은 결과는 magnolol이 NRF를 조절하여 SOCS3의 발현하는 것을 알 수 있었으며, 발현된 SOCS3는 Jak2-STAT3를 조절하는 것으로 보인다(Fig.
세포독성 및 세포사멸에서 magnolol의 영향임을 다시 확인 하기 위해 농도를 다르게 설정하여 UVB처리시 세포 데미지를 억제하였고(Fig. 3A), Jak2 억제제인 AG490의 처리가 UVB에 의해 유도된 세포의 데미지를 회복하는 양(p<0.01) 보다 magnolol의 처리가 더 많은 회복을 하는 것을 확인하였다(p<0.001).
세포증식에서도 magnolol과 ML385를 같이 처리하였을 때 세포의 성장이 억제되는 것을 알 수 있었고(Fig. 4B, p<0.001), Nrf2 luceferase 활성도 magnolol과 ML385를 동시 처리시 떨어지는 것을 확인하였다(Fig. 4C, p<0.001).
2C). 하지만, magnolol 처리 시 Jak2를 통한 STAT3의 조절은 UVB가 제일 효과적으로 억제하는 것을 확인하였다(Fig. 2D). 또한, UVB에 의해 조절되는 mRNA 발현양을 통해 UVB에 의해 증가되는 Jak2 및 STAT의 증가되는 양을 magnolol이 억제 조절하는 것을 알 수 있었다(Fig.

후속연구

SOCS3와 관련된 보고에서 IL-6에 의해 SOCS3의 발현이 조절되는 것으로 알려져 있는데[9, 13], 본 연구에서는 UVB 유도 및 magnolol의 처리에서 SOCS3의 발현이 조절되는 것은 처음으로 확인하였다. HDF 세포에서 magnolol의 UVB 데미지 억제효과는 Nrf2-SOCS3의 활성화를 통한 Jak2-STAT3 억제를 보이며, SOCS3를 중심으로 세포, 생화학적, 분자 및 병리 생리 학적 수준에서 향후 SOCS3의 구체적 기전연구를 위한 기초자료로 활용할 수 있을 것이다.

참고문헌 (30)

Agrawal, S., Gollapudi, S., Su, H. and Gupta, S. 2011. Leptin activates human B cells to secrete TNF- ${\alpha}$ , IL-6, and IL-10 via JAK2/STAT3 and p38MAPK/ERK1/2 signaling pathway. J. Clin. Immunol. 31, 472-478.
Besaratinia, A., Kim, S. I. and Pfeifer, G. P. 2008. Rapid repair of UVA-induced oxidized purines and persistence of UVB- induced dipyrimidine lesions determine the mutagenicity of sunlight in mouse cells. FASEB J. 22, 2379-2392.

상세보기
Cavinato, M., Koziel, R., Romani, N., Weinmullner, R., Jenewein, B., Hermann, M., Dubrac, S., Ratzinger, G., Grillari, J. and Schmuth, M. 2017. UVB-induced senescence of human dermal fibroblasts involves impairment of proteasome and enhanced autophagic activity. J. Gerontol. 72, 632-639.
Chen, W., Kang, J., Xia, J., Yang, B., Chen, B., Sun, W., Song, X., Xiang, W., Wang, X. and Wang, F. 2008. p53-related apoptosis resistance and tumor suppression activity in UVB-induced premature senescent human skin fibroblasts. Int. J. Mol. Med. 21, 645-653.
Chenais, B., Derjuga, A., Massrieh, W., Red-Horse, K., Bellingard, V., Fisher, S. J. and Blank, V. 2005. Functional and placental expression analysis of the human NRF3 transcription factor. Mol. Endocrinol. 19, 125-137.

상세보기
Chevillard, G., Paquet, M. and Blank, V. 2011. Nfe2l3 (Nrf3) deficiency predisposes mice to T-cell lymphoblastic lymphoma. Blood 117, 2005-2008.

상세보기
Han, X., Wang, Y., Chen, H., Zhang, J., Xu, C., Li, J. and Li, M. 2016. Enhancement of ICAM-1 via the JAK2/STAT3 signaling pathway in a rat model of severe acute pancreatitis-associated lung injury. Exp. Ther. Med. 11, 788-796.

상세보기
Hao, D., Wen, X., Liu, L., Wang, L., Zhou, X., Li, Y., Zeng, X., He, G. and Jiang, X. 2019. Sanshool improves UVB-induced skin photodamage by targeting JAK2/STAT3-dependent autophagy. Cell Death Dis. 10, 19.

상세보기
Huang, L., Hu, B., Ni, J., Wu, J., Jiang, W., Chen, C., Yang, L., Zeng, Y., Wan, R. and Hu, G. 2016. Transcriptional repression of SOCS3 mediated by IL-6/STAT3 signaling via DNMT1 promotes pancreatic cancer growth and metastasis. J. Exp. Clin. Cancer Res. 35, 27.

상세보기
Huang, Q., Han, L., Lv, R. and Ling, L. 2019. Magnolol exerts anti-asthmatic effects by regulating Janus kinase-signal transduction and activation of transcription and Notch signaling pathways and modulating Th1/Th2/Th17 cytokines in ovalbumin-sensitized asthmatic mice. Kor. J. Physiol. Pharmacol. 23, 251-261.
Ikehata, H., Mori, T., Douki, T., Cadet, J. and Yamamoto, M. 2018. Quantitative analysis of UV photolesions suggests that cyclobutane pyrimidine dimers produced in mouse skin by UVB are more mutagenic than those produced by UVC. Photochem. Photobiol. Sci. 17, 404-413.

상세보기
Kawachi, Y., Xu, X., Taguchi, S., Sakurai, H., Nakamura, Y., Ishii, Y., Fujisawa, Y., Furuta, J., Takahashi, T. and Itoh, K. 2008. Attenuation of UVB-induced sunburn reaction and oxidative DNA damage with no alterations in UVB-induced skin carcinogenesis in Nrf2 gene-deficient mice. J. Investig. Dermatol. 128, 1773-1779.
Kim, J. H., Kim, J. E., Liu, H. Y., Cao, W. and Chen, J. 2008. Regulation of interleukin-6-induced hepatic insulin resistance by mammalian target of rapamycin through the STAT3-SOCS3 pathway. J. Biol. Chem. 283, 708-715.

상세보기
Lu, S. H., Hsu, W. L., Chen, T. H. and Chou, T. C. 2015. Activation of Nrf2/HO-1signaling pathway involves the anti-inflammatory activity of magnolol in Porphyromonas gingivalis lipopolysaccharide-stimulated mouse RAW 264.7 macrophages. Int. Immunopharmacol. 29, 770-778.

상세보기
Lu, Y., Fukuyama, S., Yoshida, R., Kobayashi, T., Saeki, K., Shiraishi, H., Yoshimura, A. and Takaesu, G. 2006. Loss of SOCS3 gene expression converts STAT3 function from anti-apoptotic to pro-apoptotic. J. Biol. Chem. 281, 36683-36690.

상세보기
Narasimhan, M. and Rajasekaran, N. S. 2016. Exercise, Nrf2 and antioxidant signaling in cardiac aging. Front. Physiol. 7, 241.

상세보기
Nefedova, Y., Cheng, P., Gilkes, D., Blaskovich, M., Beg, A. A., Sebti, S. M. and Gabrilovich, D. I. 2005. Activation of dendritic cells via inhibition of Jak2/STAT3 signaling. J. Immunol. 175, 4338-4346.

상세보기
Nouhi, Z., Chevillard, G., Derjuga, A. and Blank, V. 2007. Endoplasmic reticulum association and N-linked glycosylation of the human Nrf3 transcription factor. FEBS Lett. 581, 5401-5406.

상세보기
Ressler, S., Bartkova, J., Niederegger, H., Bartek, J., Scharffetter Kochanek, K., Jansen-Durr, P. and Wlaschek, M. 2006. p16INK4A is a robust in vivo biomarker of cellular aging in human skin. Aging Cell 5, 379-389.

상세보기
Sakaue, Y., Domon, H., Oda, M., Takenaka, S., Kubo, M., Fukuyama, Y., Okiji, T. and Terao, Y. 2016. Anti-biofilm and bactericidal effects of magnolia bark-derived magnolol and honokiol on Streptococcus mutans. Microbiol. Immunol. 60, 10-16.

상세보기
Saw, C. L., Huang, M. T., Liu, Y., Khor, T. O., Conney, A. H. and Kong, A. N. 2011. Impact of Nrf2 on UVB-induced skin inflammation/photoprotection and photoprotective effect of sulforaphane. Mol. Carcinog. 50, 479-486.

상세보기
Shanuja, S., Iswarya, S., Rajasekaran, S., Dinesh, M. and Gnanamani, A. 2018. Pre-treatment of extracellular water soluble pigmented secondary metabolites of marine imperfect fungus protects HDF cells from UVB induced oxidative stress. Photochem. Photobiol. Sci. 17, 1229-1238.

상세보기
Sun, L., Liao, K. and Wang, D. 2015. Effects of magnolol and honokiol on adhesion, yeast-hyphal transition, and formation of biofilm by Candida albicans. PLoS One 10, e0117695.

상세보기
Wang, Y., Li, H., Huang, H., Liu, S., Mao, X., Wang, S., Wong, S. S-C., Xia, Z. and Irwin, M. G. 2016. Cardioprotection from emulsified isoflurane postconditioning is lost in rats with streptozotocin-induced diabetes due to the impairment of Brg1/Nrf2/STAT3 signalling. Clin. Sci. 130, 801-812.

상세보기
Wang, Y. N., Wu, W., Chen, H. C. and Fang, H. 2010. Genistein protects against UVB-induced senescence-like characteristics in human dermal fibroblast by p66Shc down-regulation. J. Dermatol. Sci. 58, 19-27.

상세보기
Wunderlich, C. M., Hovelmeyer, N. and Wunderlich, F. T. 2013. Mechanisms of chronic JAK-STAT3-SOCS3 signaling in obesity. JAKSTAT 2, e23878.

상세보기
Yan, D., Dong, J., Sulik, K. K. and Chen, S. 2010. Induction of the Nrf2-driven antioxidant response by tert-butylhydroquinone prevents ethanol-induced apoptosis in cranial neural crest cells. Biochem. Pharmacol. 80, 144-149.

상세보기
Yang, X., Gao, X., Cao, Y., Guo, Q., Li, S., Zhu, Z., Zhao, Y., Tu, P. and Chai, X. 2018. Anti-inflammatory effects of boldine and reticuline isolated from Litsea cubeba through JAK2/STAT3 and NF- ${\kappa}B$ signaling pathways. Planta Med. 84, 20-25.
Yin, L., Dai, Q., Jiang, P., Zhu, L., Dai, H., Yao, Z., Liu, H., Ma, X., Qu, L. and Jiang, J. 2018. Manganese exposure facilitates microglial JAK2-STAT3 signaling and consequent secretion of TNF-a and IL- $1{\beta}$ to promote neuronal death. Neurotoxicology 64, 195-203.
Zhao, J., Lin, W., Cao, Z., Liu, L., Zhuang, Q., Zhong, X., Hong, Z. and Peng, J. 2013. Total alkaloids of Rubus aleaefolius Poir. inhibit the STAT3 signaling pathway leading to suppression of proliferation and cell cycle arrest in a mouse model of hepatocellular carcinoma. Oncol. Rep. 30, 1309-1314.

표제어: PCR

동의어: Packet Collision Rate

용어 설명 출처 목록 (6)

용어 설명: PCR은 세균 특이성이 있는 primer를 이용하여 적은 수의 세균이 있을지라도 쉽게 검출할 수 있는 유용한 방법이며, 이를 이용하여 구강 내 치면세균막이나 타액에서 직접 세균을 검출할 수 있게 되었다[8].

내보내기 구분	파일저장 인쇄 메일전송
구성항목	기본정보 상세정보 관리번호, 논문명, 저널/프로시딩명, 저자 , 발행년, 권, 호, 시작페이지, 끝페이지, 발행기관 관리번호, 논문명, 대등논문명, 저자 , 저널/프로시딩명, 발행기관, 발행년, 발행언어, 권, 호, 시작페이지, 끝페이지, ISBN, ISSN, 주제분야, 키워드, 초록(한글), 초록(영문), 저자(소속기관)
저장형식	Text(ASCII format) Excel format RefWorks Direct Export RIS format (for Reference Manager, ProCite, EndNote), Scholar's Aids, Mendeley
메일정보	받는사람 (필수) @ 보내는사람 (선택) @ 제목 내용 KISTI 검색결과 이메일 서비스
안내	총 건의 자료가 검색되었습니다. 다운받으실 자료의 인덱스를 입력하세요. (1-10,000) 검색결과의 순서대로 최대 10,000건 까지 다운로드가 가능합니다. 데이타가 많을 경우 속도가 느려질 수 있습니다.(최대 2~3분 소요) 다운로드 파일은 UTF-8 형태로 저장됩니다. 파일의 내용이 제대로 보이지 않을실 때는 웹브라우저 상단의 보기 -> 인코딩 -> 자동선택 여부를 확인하십시오. ~ Text(ASCII format) Excel format

연합인증