2020년 전라북도 완주 소재 약용작물 전시포장에서 재배중인 범부채(Iris domestica) 140개체 가운데 3개체의 잎에서 괴사증상이 발견되었다. Reverse transcription polymerase chain reaction 검정결과 증상을 나타내는 3개체가 tomato spotted wilt virus (TSWV)에 감염된 것으로 확인되었다. 증상주로부터 분리한 TSWV 분리주 'Blackberry lily-kr1'의 전체 염기서열을 결정하였으며, 유전자 은행에 있는 다른 분리주들과 L, M, S 분절유전체 부위의 염기서열 상동성을 비교하였다. 'Blackberry lily-kr1' 분리주는 L 분절 유전체는 우리나라에서 보고한 'JJ' 분리주(MF159046) 또는 'HJ' (LC273305) 분리주와 상동성이 높았으며, M과 S 분절 유전체는 'JJ' 분리주(MF159058과 KY021439)와 가장 상동성이 높았다. MEGA X 프로그램의 maximum likelihood 방법을 이용하여 'Blackberry lily-kr1'의 다른 TSWV 분리주들과의 계통학적 연관성에 관한 분석을 한 결과 L, M, S 분절유전체 모두 고추에서 분리한 'JJ' 분리주 및 환삼덩굴(Humulus japonicas)에서 분리한 'HJ' 분리주와 높은 연관성을 보였다. 건전한 I. domestica 식물에 'Blackberry lily-kr1'을 감염시킨 Nicoatiana rustica 식물 즙액을 접종한 결과 50일 후에 잎에 괴사 또는 이중 고리형태의 괴사 증상이 형성되었다. 이는 노지에서 재배하는 범부채에서 관찰된 괴사증상이 TSWV 감염에 의한 것임을 시사하는 결과이다. 이 연구는 우리나라에서 범부채에서 TSWV 발생에 관한 최초의 보고이다.
2020년 전라북도 완주 소재 약용작물 전시포장에서 재배중인 범부채(Iris domestica) 140개체 가운데 3개체의 잎에서 괴사증상이 발견되었다. Reverse transcription polymerase chain reaction 검정결과 증상을 나타내는 3개체가 tomato spotted wilt virus (TSWV)에 감염된 것으로 확인되었다. 증상주로부터 분리한 TSWV 분리주 'Blackberry lily-kr1'의 전체 염기서열을 결정하였으며, 유전자 은행에 있는 다른 분리주들과 L, M, S 분절유전체 부위의 염기서열 상동성을 비교하였다. 'Blackberry lily-kr1' 분리주는 L 분절 유전체는 우리나라에서 보고한 'JJ' 분리주(MF159046) 또는 'HJ' (LC273305) 분리주와 상동성이 높았으며, M과 S 분절 유전체는 'JJ' 분리주(MF159058과 KY021439)와 가장 상동성이 높았다. MEGA X 프로그램의 maximum likelihood 방법을 이용하여 'Blackberry lily-kr1'의 다른 TSWV 분리주들과의 계통학적 연관성에 관한 분석을 한 결과 L, M, S 분절유전체 모두 고추에서 분리한 'JJ' 분리주 및 환삼덩굴(Humulus japonicas)에서 분리한 'HJ' 분리주와 높은 연관성을 보였다. 건전한 I. domestica 식물에 'Blackberry lily-kr1'을 감염시킨 Nicoatiana rustica 식물 즙액을 접종한 결과 50일 후에 잎에 괴사 또는 이중 고리형태의 괴사 증상이 형성되었다. 이는 노지에서 재배하는 범부채에서 관찰된 괴사증상이 TSWV 감염에 의한 것임을 시사하는 결과이다. 이 연구는 우리나라에서 범부채에서 TSWV 발생에 관한 최초의 보고이다.
In May 2020, necrosis and necrotic ring patterns were observed on leaves of three of 140 Iris domestica plants in a demonstration garden in Wanju, Jeollabuk-do. Three symptomatic plants were found to be infected by tomato spotted wilt virus (TSWV). To analyze the whole genomic sequence of one TSWV i...
In May 2020, necrosis and necrotic ring patterns were observed on leaves of three of 140 Iris domestica plants in a demonstration garden in Wanju, Jeollabuk-do. Three symptomatic plants were found to be infected by tomato spotted wilt virus (TSWV). To analyze the whole genomic sequence of one TSWV isolate, 'Blackberry lily-kr1', L, M, and S genome segments were sequenced and analyzed by comparison of nucleotide sequences of the three segments with corresponding sequences of other TSWV isolates. 'Blackberry lily-kr1' isolate was most closely related to 'JJ' isolate (MF159046) or 'HJ' isolate (LC273305) in the L segment, and to 'JJ' isolate (MF159058 and KY021439) in the M and S segments, respectively. Phylogenetic analysis by Maximum likelihood method using MEGA X program with 'Blackberry lily-kr1' isolate showed high relationship with 'JJ' pepper isolate or 'HJ' Humulus japonicas isolate in the all three segment. Necrosis and double ring patterns on leaves were formed in the glasshouse after inoculation of healthy I. domestica plants with sap of 'Blackberry lily-kr1'-infected Nicotiana rustica plants. This result suggests that I. domestica plants showing necrotic ring patterns in the open field are caused by TSWV infection. This is the first report of TSWV infection of I. domestica in Korea.
In May 2020, necrosis and necrotic ring patterns were observed on leaves of three of 140 Iris domestica plants in a demonstration garden in Wanju, Jeollabuk-do. Three symptomatic plants were found to be infected by tomato spotted wilt virus (TSWV). To analyze the whole genomic sequence of one TSWV isolate, 'Blackberry lily-kr1', L, M, and S genome segments were sequenced and analyzed by comparison of nucleotide sequences of the three segments with corresponding sequences of other TSWV isolates. 'Blackberry lily-kr1' isolate was most closely related to 'JJ' isolate (MF159046) or 'HJ' isolate (LC273305) in the L segment, and to 'JJ' isolate (MF159058 and KY021439) in the M and S segments, respectively. Phylogenetic analysis by Maximum likelihood method using MEGA X program with 'Blackberry lily-kr1' isolate showed high relationship with 'JJ' pepper isolate or 'HJ' Humulus japonicas isolate in the all three segment. Necrosis and double ring patterns on leaves were formed in the glasshouse after inoculation of healthy I. domestica plants with sap of 'Blackberry lily-kr1'-infected Nicotiana rustica plants. This result suggests that I. domestica plants showing necrotic ring patterns in the open field are caused by TSWV infection. This is the first report of TSWV infection of I. domestica in Korea.
* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.
문제 정의
그 외 지황 바이러스 병에 관한 보고(Kwak 등, 2018; Kwon 등, 2018b, 2019) 가있었다. 본 연구는 약용작물 범부채의 TSWV 발생에 관한 국내 최초 보고이다.
미국에서 보고한 범부채에 발생한 TSWV는잎에 원형황화 또는 고리모양의 증상을 나타내어 우리나라에서 관찰된 증상과 매우 유사하다. 이 연구는 우리나라에서 범부채에 TSWV 발생에 관한 우리나라 최초의 보고이다.
이는 노지에서 재배하는 범부채에서 관찰된 괴사증상이 TSWV 감염에 의한 것임을 시사하는 결과이다. 이 연구는 우리나라에서 범부채에서 TSWV 발생에 관한 최초의 보고이다.
제안 방법
RT-PCR 검정을 수행한 3그루의 PCR 산물(777 bp)의 염기서열을 조사한 결과 3그루 모두 동일하여 전체 염기서열 결정은 한 그루로부터 바이러스를 분리하여 수행하였다. ‘Blackberry lily-kr1’ 분리주의 전체 염기서열 분석을 위해 L, M, S분절 유전체 특이 프라이머(Supplementary Table 1)를 이용하여 증폭한 PCR 산물을 pGEM-T easy백터(Promega, Madison, WI, USA)에 클로닝하여 Sanger 시퀀싱 방법으로 전체 염기서열을 결정하였다(Macrogen Inc., Seoul, Korea). RT-PCR 반응은 one-step RT-PCR 제품(Genet- bio, Nonsan, Korea)을 이용하여 제조사의 권장 방법대로 수행하였다.
염기서열 결정. RNA 추출은 RNeasy plant mini kit (Qiagen, Hilden, Germany)를 이용하여 제조사의 권장 방법대로 수행하였다. 바이러스 정밀 검정을 위하여 TSWV의 nucleoprotein (N) 유전자 777 bp를 증폭하도록 제작한 특이 프라이머(TSWV777-F: ATGTCTAAGGTTAAGCTCAC; TSWV777-R: TTAAGCAAGTTCTGCGAGTT)를 이용하여 reverse transcription polymerase chain reaction (RT-PCR)을 수행하였다.
바이러스 정밀 검정을 위하여 TSWV의 nucleoprotein (N) 유전자 777 bp를 증폭하도록 제작한 특이 프라이머(TSWV777-F: ATGTCTAAGGTTAAGCTCAC; TSWV777-R: TTAAGCAAGTTCTGCGAGTT)를 이용하여 reverse transcription polymerase chain reaction (RT-PCR)을 수행하였다. RT-PCR 검정을 수행한 3그루의 PCR 산물(777 bp)의 염기서열을 조사한 결과 3그루 모두 동일하여 전체 염기서열 결정은 한 그루로부터 바이러스를 분리하여 수행하였다. ‘Blackberry lily-kr1’ 분리주의 전체 염기서열 분석을 위해 L, M, S분절 유전체 특이 프라이머(Supplementary Table 1)를 이용하여 증폭한 PCR 산물을 pGEM-T easy백터(Promega, Madison, WI, USA)에 클로닝하여 Sanger 시퀀싱 방법으로 전체 염기서열을 결정하였다(Macrogen Inc.
TSWV의 L, M 및 S 분절 유전체 특이 프라이머를 이용하여 증폭한 RT-PCR 산물에 대한 염기서열 분석을 통하여 ‘Blackberry lily-kr1’ 분리주의 전체 염기서열을 결정하였다(GenBank 등록번호 MT899477, MT921847, MT921846). ‘Blackberry lily-kr1’ 분리주의 L, M 및 S 유전체의 염기서열을 유전자은행 데이터베이스에 등록된 다른 TSWV 분리주들과의 상동성을 비교한 결과, 각각 93.
바이러스 유전자 염기서열 및 유연관계 분석. ‘TSWV-black- berry lily-kr1’ 분리주의 GenBank 데이터베이스(http://www.
RNA 추출은 RNeasy plant mini kit (Qiagen, Hilden, Germany)를 이용하여 제조사의 권장 방법대로 수행하였다. 바이러스 정밀 검정을 위하여 TSWV의 nucleoprotein (N) 유전자 777 bp를 증폭하도록 제작한 특이 프라이머(TSWV777-F: ATGTCTAAGGTTAAGCTCAC; TSWV777-R: TTAAGCAAGTTCTGCGAGTT)를 이용하여 reverse transcription polymerase chain reaction (RT-PCR)을 수행하였다. RT-PCR 검정을 수행한 3그루의 PCR 산물(777 bp)의 염기서열을 조사한 결과 3그루 모두 동일하여 전체 염기서열 결정은 한 그루로부터 바이러스를 분리하여 수행하였다.
1B), TSWV에 감염된 것을 RT-PCR로 확인하였다 (자료 미제공). 접종 후 시간 경과에 따라 증상이 변했으며, 50 일 후에는 자연 감염된 범부채에서와 유사한 고리형태의 괴사 증상으로 변했다(Fig. 1B).
Reverse transcription polymerase chain reaction 검정결과 증상을 나타내는 3개체가 tomato spotted wilt virus (TSWV)에 감염된 것으로 확인되었다. 증상 주로부터 분리한 TSWV 분리주 ‘Blackberry lily-kr1’의 전체 염기서열을 결정하였으며, 유전자 은행에 있는 다른 분리주들과 L, M, S 분절 유전체 부위의 염기서열 상동성을 비교하였다. ‘Blackberry lily- kr1’ 분리주는 L 분절 유전체는 우리나라에서 보고한 ‘JJ’ 분리 주(MF159046) 또는 ‘HJ’ (LC273305) 분리주와 상동성이 높았으며, M과 S 분절 유전체는 ‘JJ’ 분리주(MF159058과 KY021439) 와가장 상동성이 높았다.
대상 데이터
바이러스병 발생지 및 증상. 2020년 4월 전라북도 완주군에 위치한 국립원예특작과학원 시범포에서 재배중인 범부채 (Iris domestica) 140여 그루 가운데 3그루의 잎에서 전형적인토스포바이러스 감염 증상인 부정형 또는 고리형의 괴사증 상이 발견되었다.
2020년 전라북도 완주 소재 약용작물 전시포장에서 재배 중인 범부채(Iris domestica) 140개체 가운데 3개체의 잎에서 괴사증상이 발견되었다. Reverse transcription polymerase chain reaction 검정결과 증상을 나타내는 3개체가 tomato spotted wilt virus (TSWV)에 감염된 것으로 확인되었다.
데이터처리
‘TSWV-black- berry lily-kr1’ 분리주의 GenBank 데이터베이스(http://www. ncbi.nlm.nih.gov/genbank)에 등록된 다른 분리주들과의 염기서열 상동성은 DNAStar 프로그램의 Clustral W 방법으로 정렬하여 비교하였으며, 다른 분리주들과의 계통학적 연관성을 추정하기 위해서 MEGA X 프로그램을 사용하여 maximum likelihood method로 분석하였다(Kumar 등, 2018). 계통수의 가지에 대한 통계적 유의성은 bootstrap 1,000반복을 수행하는 방법으로 분석하였다.
gov/genbank)에 등록된 다른 분리주들과의 염기서열 상동성은 DNAStar 프로그램의 Clustral W 방법으로 정렬하여 비교하였으며, 다른 분리주들과의 계통학적 연관성을 추정하기 위해서 MEGA X 프로그램을 사용하여 maximum likelihood method로 분석하였다(Kumar 등, 2018). 계통수의 가지에 대한 통계적 유의성은 bootstrap 1,000반복을 수행하는 방법으로 분석하였다.
이론/모형
, Seoul, Korea). RT-PCR 반응은 one-step RT-PCR 제품(Genet- bio, Nonsan, Korea)을 이용하여 제조사의 권장 방법대로 수행하였다.
성능/효과
증상 주로부터 분리한 TSWV 분리주 ‘Blackberry lily-kr1’의 전체 염기서열을 결정하였으며, 유전자 은행에 있는 다른 분리주들과 L, M, S 분절 유전체 부위의 염기서열 상동성을 비교하였다. ‘Blackberry lily- kr1’ 분리주는 L 분절 유전체는 우리나라에서 보고한 ‘JJ’ 분리 주(MF159046) 또는 ‘HJ’ (LC273305) 분리주와 상동성이 높았으며, M과 S 분절 유전체는 ‘JJ’ 분리주(MF159058과 KY021439) 와가장 상동성이 높았다. MEGA X 프로그램의 maximum likelihood 방법을 이용하여 ‘Blackberry lily-kr1’의 다른 TSWV 분리 주들과의 계통학적 연관성에 관한 분석을 한 결과 L, M, S 분절 유전체 모두 고추에서 분리한 ‘JJ’ 분리주 및 환삼덩굴(Humu- lus japonicas)에서 분리한 ‘HJ’ 분리주와 높은 연관성을 보였다.
MT899477, MT921847, MT921846). ‘Blackberry lily-kr1’ 분리주의 L, M 및 S 유전체의 염기서열을 유전자은행 데이터베이스에 등록된 다른 TSWV 분리주들과의 상동성을 비교한 결과, 각각 93.5‒99.6%, 92.9‒99.4%, 95.4‒99.1%의 유사성을 보였다 (Fig. 2). L 유전체는 우리나라에서 고추로부터 분리하여 보고한 ‘JJ’ 분리주(MF159046) 및 환삼덩굴(Humulus japonicas)에서 분리한 ‘HJ’ 분리주(LC273305)와 상동성이 가장 높았으며, M 및 S 유전체는 ‘JJ’ 분리주(각각MF159058와 KY021439)와 가장 상동성이 높았다(Fig.
domestica plants infected with TSWV naturally in the open field. (B) Systemic chlorosis on leaves (left picture, arrow) and necrosis or double ring patterns (right picture) were shown in the glasshouse 12 days and 50 days after inoculation of healthy I. domestica plants with sap of ‘Black- berry lily-kr1’-infected Nustica rustica plants, respectively.
추가로 전자현미경(LEO 906, Zeiss, Oberkochen, Germany)을 이용하여 범부채의 즙액을 dip 방법(Chung 등, 2006)으로 2% potassium phosphotungstic acid 염색 후 바이러스 입자를 관찰하였으나, 사상형의 바이러스 입자는 관찰되지 않았다(자료 미제공). Immunostrip (Agdia)으로 양성반응을 보인 범부채 3그루를(Fig. 1A) TSWV 특이 프라이머를 이용하여 RT-PCR 검정한 결과 기대하는 크기의 PCR 산물이 증폭되었다(자료 미제공).
2). L 유전체는 우리나라에서 고추로부터 분리하여 보고한 ‘JJ’ 분리주(MF159046) 및 환삼덩굴(Humulus japonicas)에서 분리한 ‘HJ’ 분리주(LC273305)와 상동성이 가장 높았으며, M 및 S 유전체는 ‘JJ’ 분리주(각각MF159058와 KY021439)와 가장 상동성이 높았다(Fig. 2). MEGA X 프로그램의 maximum likelihood 방법을 이용하여 ‘Blackberry lily-kr1’ 분리주의 다른 TSWV 분리 주들과의 계통학적 연관성을 분석한 결과, L, M 및 S 분절 유전체 모두 고추에서 분리한 ‘JJ’ 분리주(MF159046, MF159058, KY021439) 및 환삼덩굴에서 분리한 ‘HJ’ 분리주(LC273305, LC273306, LC273307)와 높은 연관성을 보였다(Fig.
2). MEGA X 프로그램의 maximum likelihood 방법을 이용하여 ‘Blackberry lily-kr1’ 분리주의 다른 TSWV 분리 주들과의 계통학적 연관성을 분석한 결과, L, M 및 S 분절 유전체 모두 고추에서 분리한 ‘JJ’ 분리주(MF159046, MF159058, KY021439) 및 환삼덩굴에서 분리한 ‘HJ’ 분리주(LC273305, LC273306, LC273307)와 높은 연관성을 보였다(Fig. 3).
‘Blackberry lily- kr1’ 분리주는 L 분절 유전체는 우리나라에서 보고한 ‘JJ’ 분리 주(MF159046) 또는 ‘HJ’ (LC273305) 분리주와 상동성이 높았으며, M과 S 분절 유전체는 ‘JJ’ 분리주(MF159058과 KY021439) 와가장 상동성이 높았다. MEGA X 프로그램의 maximum likelihood 방법을 이용하여 ‘Blackberry lily-kr1’의 다른 TSWV 분리 주들과의 계통학적 연관성에 관한 분석을 한 결과 L, M, S 분절 유전체 모두 고추에서 분리한 ‘JJ’ 분리주 및 환삼덩굴(Humu- lus japonicas)에서 분리한 ‘HJ’ 분리주와 높은 연관성을 보였다. 건전한 I.
범부채(Iris domestica) 140개체 가운데 3개체의 잎에서 괴사증상이 발견되었다. Reverse transcription polymerase chain reaction 검정결과 증상을 나타내는 3개체가 tomato spotted wilt virus (TSWV)에 감염된 것으로 확인되었다. 증상 주로부터 분리한 TSWV 분리주 ‘Blackberry lily-kr1’의 전체 염기서열을 결정하였으며, 유전자 은행에 있는 다른 분리주들과 L, M, S 분절 유전체 부위의 염기서열 상동성을 비교하였다.
Alignments were conducted with complete nucleotide sequences of L (MT899477) (A), M (MT921847) (B), and S (MT921846) (C) genome segments of ‘Blackberry lily-kr1’. The range of nucleotide sequence identity for the complete nucleotide sequence of the L, M and S genome segments with other TSWV isolates was 93.5‒99.6%, 92.9‒99.4%, and 95.4‒99.1%, respectively. ‘Blackberry lily-kr1’ was most closely related to ‘JJ’ isolate (MF159046) or ‘HJ’ isolate (LC273305) in the L genome segment, and to ‘JJ’ isolate (MF159058 and KY021439) from South Korea in the M and S genome segments, respectively.
MEGA X 프로그램의 maximum likelihood 방법을 이용하여 ‘Blackberry lily-kr1’의 다른 TSWV 분리 주들과의 계통학적 연관성에 관한 분석을 한 결과 L, M, S 분절 유전체 모두 고추에서 분리한 ‘JJ’ 분리주 및 환삼덩굴(Humu- lus japonicas)에서 분리한 ‘HJ’ 분리주와 높은 연관성을 보였다. 건전한 I. domestica 식물에 ‘Blackberry lily-kr1’을 감염시킨 Nicoatiana rustica 식물 즙액을 접종한 결과 50일 후에 잎에 괴사 또는 이 중 고리형태의 괴사 증상이 형성되었다. 이는 노지에서 재배하는 범부채에서 관찰된 괴사증상이 TSWV 감염에 의한 것임을 시사하는 결과이다.
괴사 증상을 나타내는 범부채의(Fig. 1A) 바이러스 감염 여부를 Immunostrip (Agdia, Elkhart, IN, USA)을 이용하여 TSWV, impatiens necrotic spot virus 및 cucumber mosaic virus 감염 여부를 진단한 결과 TSWV는 양성반응이 나왔으며, 나머지 바이러스는 모두 음성반응이 나왔다(자료 미제공). 추가로 전자현미경(LEO 906, Zeiss, Oberkochen, Germany)을 이용하여 범부채의 즙액을 dip 방법(Chung 등, 2006)으로 2% potassium phosphotungstic acid 염색 후 바이러스 입자를 관찰하였으나, 사상형의 바이러스 입자는 관찰되지 않았다(자료 미제공).
괴사증상을 나타내는 범부채 한 그루의 잎으로부터 준비한 즙액을 Nicotiana rustica에 인공접종한 결과 7일 후에 상엽에서 황화 및 괴사증상이 나타났으며, TSWV에 전신감염된 것을 RT- PCR로 확인한 결과 동일한 사이즈의 증폭산물인 것을 확인하였다(자료 미제공). 이 분리주를 ‘Blackberry lily-kr1’로 명명하였다.
염기서열 분석 결과를 바탕으로 추정한 결과 범부채를 감염시킨 TSWV는 국내에서 고추 재배지 또는 잡초로부터 전염된 것으로 보인다. 범부채에서 TSWV의 최초 발생은 세계적으로 1977년에 일본에서 보고되었으며(Yamamoto와 Ohata, 1977), 2003년에 미국에서 범부채에 TSWV 발생에 관하여 보고하였다 (Adkins 등, 2003).
전신 감염이 확인된 N. rustica 잎의 즙액을 건전한 범 부채에 인공접종한 후 12일에 범부채의 잎에 황화 및 괴사 증상이 나타났으며(Fig. 1B), TSWV에 감염된 것을 RT-PCR로 확인하였다 (자료 미제공). 접종 후 시간 경과에 따라 증상이 변했으며, 50 일 후에는 자연 감염된 범부채에서와 유사한 고리형태의 괴사 증상으로 변했다(Fig.
참고문헌 (24)
Adkins, S., Breman, L., Baker, C. A. and Wilson, S. 2003. First report of tomato spotted wilt virus in blackberry lily in North America. Plant Dis. 87: 102.
Brittlebank, C. C. 1919. Tomato diseases. J. Agric. Vic. 27: 231-235.
Cho, J.-D., Kim, J.-S., Kim, J.-Y., Kim, J.-H., Lee, S.-H., Choi, G.-S. et al. 2005. Occurrence and symptoms of tomato spotted wilt virus on vegetables in Korea (I). Res. Plant Dis. 11: 213-216. (In Korean)
Cho, J.-D., Kim, J.-Y., Kim, J.-S., Choi, H.-S. and Choi, G.-S. 2010. Occurrence and symptoms of tomato spotted wilt virus on egg plants, whole radish and sugar loaf in Korea. Res. Plant Dis. 16: 232-237. (In Korean)
Cho, S.-Y., Kim, S.-M., Kim, S. and Lee, B. C. 2020. First report of tomato spotted wilt virus infecting Arachis hypogaea in Korea. J. Plant Pathol. 102: 271.
Choi, H. S., Lee, S. H., Kim, M. K., Kwak, H. R., Kim, J. S., Cho, J. D. et al. 2010. Occurrence of virus diseases on major crops in 2009. Res. Plant Dis. 16: 1-9. (In Korean)
Choi, S.-K., Cho, I.-S., Choi, G.-S. and Yoon, J.-Y. 2014. First report of tomato spotted wilt virus in Brugmansia suaveolens in Korea. Plant Dis. 98: 1283.
Chung, B. N., Pak, H. S., Jung, J. A. and Kim, J. S. 2006. Occurrence of tomato spotted wilt virus in chrysanthemum (Dendranthema grandiflorum) in Korea. Plant Pathol. J. 22: 230-234.
Igori, D., Lee, H.-K., Yang, H.-J., Lee, D.-S., Kim, S.-Y., Kwon, B. et al. 2020. First report of the cycas necrotic stunt virus infecting Cnidium officinale in South Korea. Plant Dis. 104: 3275.
Kim, J.-H., Choi, G.-S., Kim, J.-S. and Choi, J.-K. 2004. Characterization of tomato spotted wilt virus from Paprika in Korea. Plant Pathol. J. 20: 297-301.
Kim, M., Kim, J. E., Kim, J., Kwak, H. R., Choi, H. S., Lee, H. J. et al. 2018. First report of tomato spotted wilt virus in Hoya carnosa in Korea. Plant Dis. 102: 1672.
Kumar, S., Stecher, G., Li, M., Knyaz, C. and Tamura, K. 2018. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35: 1547-1549.
Kwak, H.-R., Kim, M., Kim, J., Choi, H.-S., Seo, J.-K. and Ko, S.-J. 2018. First report of plantago asiatica mosaic virus in Rehmannia glutinosa in Korea. Plant Dis. 102: 1046.
Kwon, S.-J., Cho, I.-S., Yoon, J.-Y. and Chung, B.-N. 2018a. Incidence and occurrence pattern of viruses on peppers growing in fields in Korea. Res. Plant Dis. 24: 66-74. (In Korean)
Kwon, S.-J., Jin, M., Cho, I.-S., Yoon, J.-Y. and Choi, G.-S. 2018b. Identification of rehmannia virus 1, a novel putative member of the genus Closterovirus, from Rehmannia glutinosa. Arch. Virol. 163: 3383-3388.
Kwon, S.-J., Yoon, J.-Y., Cho, I.-S. and Choi, G.-S. 2019. The incidence of virus diseases in Rehmannia glutinosa in Korea. Res. Plant Dis. 25: 38-42. (In Korean)
Parrella, G., Gognalons, P., Gebre-Selassie, K., Vovlas, C. and Marchoux, G. 2003. An update of the host range of tomato spotted wilt virus. J. Plant Pathol. 85: 227-264.
Samuel, G., Bald, J. G. and Pittman, H. A. 1930. Investigations on "Spotted Wilt" of Tomatoes. Australian Council for Scientific and Industrial Research, Melbourne, Austrailia. 64 pp.
Yamamoto, T. and Ohata, K. 1977. Some properties and electron microscopy of tomato spotted wilt virus isolated from blackberry lily (Belamcanda chinensis DC). Bull. Shikoku Agric. Exp. Stn. 30: 39-47.
Yoo, R. H., Zhao, F., Lim, S., Igori, D., Kim, S.-M., An, T.-J. et al. 2015. The complete genome sequences of two isolates of cnidium vein yellowing virus, a tentative new member of the family Secoviridae. Arch. Virol. 160: 2911-2914.
Yoon, J. Y., Choi, G. S., Kwon, S. J. and Choi, I. S. 2019. First report of tomato spotted wilt virus infecting Peperomia obtusifolia in South Korea. Plant Dis. 103: 593.
Yoon, Y. N., Jo, Y., Cho, W. K., Choi, H., Jang, Y., Lee, Y. H. et al. 2018. First report of tomato spotted wilt virus infecting soybean in Korea. Plant Dis. 102: 461.
※ AI-Helper는 부적절한 답변을 할 수 있습니다.