[국내논문]Oligopeptide transporter 관여 유전자 도입 형질전환벼의 고온스트레스 내성 증진 Overexpression of an oligopeptide transporter gene enhances heat tolerance in transgenic rice원문보기
지구온난화로 인해 온도 상승에 따른 고온 스트레스는 전세계 많은 지역에서 농업적으로 문제가 되어 세계 3대 곡물인 벼의 생산에 피해가 크게 나타나고 있다. 식물은 생장하면서 다양한 환경스트레스에 노출되며, 이러한 스트레스는 작물의 생장, 발달, 수확량 등에 영향을 미친다. 본 연구는 벼의 안정적인 생산성을 높이기 위해 벼 유래 OsOPT 유전자를 이용한 형질전환 후대에서 고온 조건하에서도 생육이 가능한 계통을 선발하여 그 특성을 살펴보았다. 먼저, OsOPT10 유전자 도입 형질전환 벼를 이용하여 고온 처리에 따른 저항성 계통을 선발하고, 선발된 계통의 생리적 특성을 분석하였으며, 분자적 특성을 qRT-PCR을 통해 유전자의 발현 양상을 분석하였다. 고온 스트레스에 의한 세포막 피해 정도를 알아보기 위해 전해질 누출(electrolyteleakage), 삼투조절제 역할을 하는 수용성 당 및 proline 함량 분석을 하여 대조구와 비교분석 하였다. 본 실험에서 고온 처리에 의한 가용성 당 함량의 변화는 OsOPT10-16 형질전환 벼를 제외하고 OsOPT10-1와 OsOPT10-7 계통이 WT 보다 당 함량이 높게 나타났다. 모품종 동진에 비해 형질전환 벼 계통의 EL 값이 낮게 나타난 것과 가용성 당 함량이 비슷하거나 높게 나타난 것으로 보아 OsOPT10 형질전환 벼가 고온 스트레스에서 저항성 반응을 나타낸 것으로 판단하였다.
지구온난화로 인해 온도 상승에 따른 고온 스트레스는 전세계 많은 지역에서 농업적으로 문제가 되어 세계 3대 곡물인 벼의 생산에 피해가 크게 나타나고 있다. 식물은 생장하면서 다양한 환경스트레스에 노출되며, 이러한 스트레스는 작물의 생장, 발달, 수확량 등에 영향을 미친다. 본 연구는 벼의 안정적인 생산성을 높이기 위해 벼 유래 OsOPT 유전자를 이용한 형질전환 후대에서 고온 조건하에서도 생육이 가능한 계통을 선발하여 그 특성을 살펴보았다. 먼저, OsOPT10 유전자 도입 형질전환 벼를 이용하여 고온 처리에 따른 저항성 계통을 선발하고, 선발된 계통의 생리적 특성을 분석하였으며, 분자적 특성을 qRT-PCR을 통해 유전자의 발현 양상을 분석하였다. 고온 스트레스에 의한 세포막 피해 정도를 알아보기 위해 전해질 누출(electrolyte leakage), 삼투조절제 역할을 하는 수용성 당 및 proline 함량 분석을 하여 대조구와 비교분석 하였다. 본 실험에서 고온 처리에 의한 가용성 당 함량의 변화는 OsOPT10-16 형질전환 벼를 제외하고 OsOPT10-1와 OsOPT10-7 계통이 WT 보다 당 함량이 높게 나타났다. 모품종 동진에 비해 형질전환 벼 계통의 EL 값이 낮게 나타난 것과 가용성 당 함량이 비슷하거나 높게 나타난 것으로 보아 OsOPT10 형질전환 벼가 고온 스트레스에서 저항성 반응을 나타낸 것으로 판단하였다.
Rice (Oryza sativa) cultivars show an impairment of growth and development in response to abiotic stresses such as drought, salinity, heat and cold at the early seedling stage. The tolerance to heat stress in plants has been genetically modulated by the overexpression of heat shock transcription fac...
Rice (Oryza sativa) cultivars show an impairment of growth and development in response to abiotic stresses such as drought, salinity, heat and cold at the early seedling stage. The tolerance to heat stress in plants has been genetically modulated by the overexpression of heat shock transcription factor genes or proteins. In addition to a high temperature-tolerance that has also been altered by elevating levels of osmolytes, increasing levels of cell detoxification enzymes and through altering membrane fluidity. To examine the heat tolerance in transgenic rice plants, three OsOPT10 overexpressing lines were characterized through a physiological analysis, which examined factors such as the electrolyte leakage (EL), soluble sugar and proline contents. We further functionally characterized the OsOPT10 gene and found that heat induced the expression of OsOPT10 and P5CS gene related proline biosynthesis. It has been suggested that the expression of OsOPT10 led to elevated heat tolerance in transgenic lines.
Rice (Oryza sativa) cultivars show an impairment of growth and development in response to abiotic stresses such as drought, salinity, heat and cold at the early seedling stage. The tolerance to heat stress in plants has been genetically modulated by the overexpression of heat shock transcription factor genes or proteins. In addition to a high temperature-tolerance that has also been altered by elevating levels of osmolytes, increasing levels of cell detoxification enzymes and through altering membrane fluidity. To examine the heat tolerance in transgenic rice plants, three OsOPT10 overexpressing lines were characterized through a physiological analysis, which examined factors such as the electrolyte leakage (EL), soluble sugar and proline contents. We further functionally characterized the OsOPT10 gene and found that heat induced the expression of OsOPT10 and P5CS gene related proline biosynthesis. It has been suggested that the expression of OsOPT10 led to elevated heat tolerance in transgenic lines.
* AI 자동 식별 결과로 적합하지 않은 문장이 있을 수 있으니, 이용에 유의하시기 바랍니다.
문제 정의
처리 10일 후에, 형질전환체 OsOPT10-1, 7, 16 계통은 대조구(WT)와 OsOPT10-2, 4, 5 계통에 비해 피해 수준 및 저항성 정도가 차이가 있었으나 큰 차이는 보이지 않 았다. 그래서, 스트레스에 의한 세포막 피해 정도를 알아보기 위해 대표적인 표시자로 알려진 전해질 누출(electrolyte leakage) 분석을 하여 세포막 피해 정도를 비교하고자 하였 다(Allen et al. 1997). 일반 환경조건에서는 모품종(WT) 및 OsOPT10-1, 7, 16 계통의 전해질 누출(EL) 정도에 차이는 보이지 않았으나, 10일 고온 처리 후 WT의 EL 값은 형질전환 벼 3 계통에 비해 높게 나타났다.
2010). 따라서 본 논문에서는 올리고펩 타이드 전달체 관련 유전자(OsOPT10)가 도입된 형질전환 벼에서 고온 스트레스 저항성 계통을 선발하고, 이들과 관련된 다양한 유전자 발현양상에 대한 분자적 특성에 대해 기술하고자 연구를 수행하였다.
식물은 생장하면서 다양한 환경스트레스에 노출되며, 이러한 스트레스는 작물의 생장, 발달, 수확량 등에 영향을 미친다. 본 연구는 벼의 안정적인 생산성을 높이기 위해 벼 유래 OsOPT 유전자를 이용한 형질전환 후대에서 고온 조건하에서도 생육이 가능한 계통을 선발하여 그 특성을 살펴보았다. 먼저, OsOPT10 유전자 도입 형질전환 벼를 이용하여 고온 처리에 따른 저항성 계통을 선발하고, 선발된 계통의 생리적 특성을 분석하였으 며, 분자적 특성을 qRT-PCR을 통해 유전자의 발현 양상을 분석하였다.
제안 방법
42°C 고온 스트레스를 유도하기 위해, 식물 생장상(습도: 50%, 온도: 42°C, 16시간 명/ 8시간 암 주기)에서 14일간 고온에서 생육시켰다.
OsOPT10 (Fw: 5- TCAAGGAGCATGTGCTCATCA -3’, Rv: 5- TCAGG AAGAACTGCAGCCT -3’) 프라이머를 이용하여 qRT-PCR 수행하였다.
OsOPT10의 과발현이 벼에서 고온 스트레스 내성과 관련 있는지를 조사하 기 위해, 형질전환 벼 유묘기 식물 및 대조구(WT, 동진)를 고온(42°C) 스트레스에 노출시켰다(Fig. 2).
먼저, OsOPT10 유전자 도입 형질전환 벼를 이용하여 고온 처리에 따른 저항성 계통을 선발하고, 선발된 계통의 생리적 특성을 분석하였으 며, 분자적 특성을 qRT-PCR을 통해 유전자의 발현 양상을 분석하였다. 고온 스트레스에 의한 세포막 피해 정도를 알아보기 위해 전해질 누출(electrolyte leakage), 삼투조절제 역할을 하는 수용성 당 및 proline 함량 분석을 하여 대조구와 비교분석 하였다. 본 실험에서 고온 처리에 의한 가용성 당 함량의 변화는 OsOPT10-16 형질전환 벼를 제외하고 OsOPT10-1 와 OsOPT10-7 계통이 WT 보다 당 함량이 높게 나타났다.
, 1997). 고온 처리 후 proline 함량의 변화를 살펴보기 위해, WT과 OsOPT10 형질전환 벼를 3 엽기 단계에서 고온 스트레스를 2일 처리하여 proline 함량을 3반복으로 측정하였고 그 결과는 Figure 4(A)와 같다. WT의 proline 함량이 1.
이후 autoclave 로 20분간 고온 고압 처리하고 다시 상온이 되었을 때, 한번 더 EC meter로 수치를 측정하여 EC2값을 얻었다. 구해진 EC1 과 EC2로 EL값을 구하고 스트레스 처리 전과 처리 11일후 측 정치인 EL1과 EL2 값을 측정 비교하였다(Dionisio-Sese and Tobita 1998).
형질전환체의 분자적특성 및 발현분석은 Jung 등(2010)에 의해 보고된 바와 같다. 그 후 형질전환 벼 16개체를 얻어 유전자 도입여부를 PCR로 검정하여 그 개체의 후대를 육성하였으며, T1 세대에 서 35S 프라이머와 OsOPT10 유전자 프라이머를 이용하여 도입여부를 확인하였다. 16개의 후대를 분석한 결과 7개의 후대에서 유전자가 안정적으로 도입되어 발현되고 있음을 확인하였다(Fig.
다음과 같이 프라이머를 제작하여35S-Fw (5’-TTCGCAA GACCCTTCCTCTA-3’)와 OsOPT10-Rv (5’- TCAGGAAGAA CTGCAGCCT-3’) 95°C에서 5분간 pre-denaturation 시킨 후, 95°C에서 30초간 denaturation, 55°C에서 30초간 annealing, 72°C에서 1분간 extension 과정을 30 cycles하였으며, 마지막 으로 72°C에서 10분간 extension을 실시하여 분석하였다.
다음과 같이 프라이머를 제작하여35S-Fw (5’-TTCGCAA GACCCTTCCTCTA-3’)와 OsOPT10-Rv (5’- TCAGGAAGAA CTGCAGCCT-3’) 95°C에서 5분간 pre-denaturation 시킨 후, 95°C에서 30초간 denaturation, 55°C에서 30초간 annealing, 72°C에서 1분간 extension 과정을 30 cycles하였으며, 마지막 으로 72°C에서 10분간 extension을 실시하여 분석하였다. 도입 유전자의 single copy 여부를 확인하기 위하여Taq-Man probe real-time PCR 분석을 수행하였다. 추출한 주형 DNA 30 ng에 2 x brilliant II QPCR master mix(Roche, Switzerland) 10 µl, 20 x Tublin (reporter VIC, Quancher TAMRA) 1 µl, 20 x Nos (reporter FAM, Quancher none) 1 µl를 PCR tube에 3반복으로 넣었으며, 양성 대조군은 검증된 homo 계통 형질전환체의 DNA 를 이용하였고, 음성 대조군은 동진의 DNA를 사용하였다.
본 연구는 벼의 안정적인 생산성을 높이기 위해 벼 유래 OsOPT 유전자를 이용한 형질전환 후대에서 고온 조건하에서도 생육이 가능한 계통을 선발하여 그 특성을 살펴보았다. 먼저, OsOPT10 유전자 도입 형질전환 벼를 이용하여 고온 처리에 따른 저항성 계통을 선발하고, 선발된 계통의 생리적 특성을 분석하였으 며, 분자적 특성을 qRT-PCR을 통해 유전자의 발현 양상을 분석하였다. 고온 스트레스에 의한 세포막 피해 정도를 알아보기 위해 전해질 누출(electrolyte leakage), 삼투조절제 역할을 하는 수용성 당 및 proline 함량 분석을 하여 대조구와 비교분석 하였다.
모품종 동진벼와 OsOPT10 형질전환체를 가지고 가용성 당 함량을 분석하였으며, 유묘기 단계인 고온 스트레스 2일차로 실험을 하였으며, 총당 함량은 페놀황산법을 이용하여 3 반복으로 측정하였다. 시약은 9% (v/v) phenol을 사용하였다.
모품종 동진벼와 OsOPT10 형질전환체를 실험재료로 하여, 유묘기 단계에서 고온 스트레스 2일차로 실험을 진행하였 다. 표본 0.
모품종 동진을 포함하여 OsOPT10-1, 2, 4, 5, 7, 16 계통을 고온 스트레스 처리 후 저항성 검정을 하였다. OsOPT10의 과발현이 벼에서 고온 스트레스 내성과 관련 있는지를 조사하 기 위해, 형질전환 벼 유묘기 식물 및 대조구(WT, 동진)를 고온(42°C) 스트레스에 노출시켰다(Fig.
반응액을 SteponeTM real-time PCR system (Life technologies, USA)기기를 이용하여 Taq-Man PCR을 수행하였으며, 반응 조건은 95°C에서 10분간 pre-denaturation 시킨 후, 95°C에서 15초간 denaturation, 60°C에서 1분간 annealing으로 40 cycle을 설정하였다.
벼 유래 OPT10 (Oligopeptide transporter 10) 유전자를 Agrobacterium 방법으로 도입하여 형질전환 벼를 육성하였으며 그 형질전환벼들을 이용하여 T1, T2 및 T3 계통을 육성하였으며 고온 스트레스에 대한 내성 형질전환체를 선발 및 분자적 특성을 조사하는데 식물 재료로 사용하였고(Jung et al. 2010), OsOPT10유전자 형질전환 벼의 분석에는 모품종인 동진벼(Oryza sativa, Japonica)를 대조구로 이용하였다
벼 유래 OPT10유전자는 식물의 모든 조직에서 발현을 유도하는 CaMV 35S 프로모터에 의해 제어되도록 Ti-plasmid vector 에 구축하여 형질전환 실험을 수행하였다. 형질전환체의 분자적특성 및 발현분석은 Jung 등(2010)에 의해 보고된 바와 같다.
삼투압 조절과 관련된 유전자중 proline 합성에 관여하는 P5CS 유전자를 이용하여 대조구와 형질전환 벼 3 계통간 전사체 발현 양상을 알아보기 위하여, 고온 처리 후(42°C, 0 h, 6 h, 24 h, 48 h) 대조구와 OsOPT10-1, -7, -16 계통간 발현양을 비교하였다(Fig. 4B).
생존한 형질전환체와 대조구 품종을 토양으로 이식 한 후, 28 ~ 30°C의 온실(16시간 명/8시간 암 주기)에서 3엽기까지 생육 후 한 포트 (10.5 × 10.5 × 11 cm) 당20개체씩 3반복이 되도록 이식하였다.
실험 방법은 시험관에 표본으로부터 잘라낸 잎 0.1 g과 멸균 수 8 ml를 혼합한 후, 항온수조에서 100°C 30분간 2번 가열하 였다.
재분화 식물체를 대상으로 벼 게놈 상에서 OsOPT10 유전자의 도입을 확인하기 위해 재분화된 잎으로부터 게놈의DNA를 분리하여 35S 프로모터부위와 도입유전자 OsOPT10유전자 특이 증폭용 프라이머를 이용하여 PCR 분석을 수행하였다. 다음과 같이 프라이머를 제작하여35S-Fw (5’-TTCGCAA GACCCTTCCTCTA-3’)와 OsOPT10-Rv (5’- TCAGGAAGAA CTGCAGCCT-3’) 95°C에서 5분간 pre-denaturation 시킨 후, 95°C에서 30초간 denaturation, 55°C에서 30초간 annealing, 72°C에서 1분간 extension 과정을 30 cycles하였으며, 마지막 으로 72°C에서 10분간 extension을 실시하여 분석하였다.
정량적 실시간 PCR 실험을 위해, SYBR® Green Realtime PCR Master Mix (Toyobo, JAPAN)와 Light Cycler (Bio-Rad CFX96TM real-time PCR detection system) 기기를 사용하였다.
추출한 주형 DNA 30 ng에 2 x brilliant II QPCR master mix(Roche, Switzerland) 10 µl, 20 x Tublin (reporter VIC, Quancher TAMRA) 1 µl, 20 x Nos (reporter FAM, Quancher none) 1 µl를 PCR tube에 3반복으로 넣었으며, 양성 대조군은 검증된 homo 계통 형질전환체의 DNA 를 이용하였고, 음성 대조군은 동진의 DNA를 사용하였다.
형질전환벼 및 모품종(WT) 동진벼(Oryza sativa cv Dongjin)종자를 1/2MS + phosphinotricin (2 ppm) 배지와1/2 MS 고체 배지에 각각 치상하여 28°C의 명조건 생장상에서 10일간 생육시켰다.
대상 데이터
모품종 동진벼와 OsOPT10 형질전환체를 가지고 가용성 당 함량을 분석하였으며, 유묘기 단계인 고온 스트레스 2일차로 실험을 하였으며, 총당 함량은 페놀황산법을 이용하여 3 반복으로 측정하였다. 시약은 9% (v/v) phenol을 사용하였다. 실험 방법은 시험관에 표본으로부터 잘라낸 잎 0.
성능/효과
그 후 형질전환 벼 16개체를 얻어 유전자 도입여부를 PCR로 검정하여 그 개체의 후대를 육성하였으며, T1 세대에 서 35S 프라이머와 OsOPT10 유전자 프라이머를 이용하여 도입여부를 확인하였다. 16개의 후대를 분석한 결과 7개의 후대에서 유전자가 안정적으로 도입되어 발현되고 있음을 확인하였다(Fig. 1A). OsOPT10 유전자의 발현을 확인한 결과, OsOPT10-4, 8 형질전환체에서 발현량이 가장 높았고 다음 순으로 OsOPT10-2, 7, 5, 1, 16순 이었으며, 대조 품종인 동진에서는 발현되지 않았다(Fig.
1A). OsOPT10 유전자의 발현을 확인한 결과, OsOPT10-4, 8 형질전환체에서 발현량이 가장 높았고 다음 순으로 OsOPT10-2, 7, 5, 1, 16순 이었으며, 대조 품종인 동진에서는 발현되지 않았다(Fig. 1B). 벼 게놈내에 OsOPT10 유전자의 single copy 도입여부를 확인하기 위하여 수행한 copy number assay 결과는 single, two copy 및 multiple copy로 도 입된 것을 확인할 수 있었다(Fig.
4B). 그 결과, 대조구는 고온처리에 의해 P5CS 유전자의 발현차이를 보이지 않았으나, 형질전환 벼 인 OsOPT10계통은 모두 무처리와 비교했을 때 보다 작게는 4배 크게는 20배 이상 발현을 나타내었다. 고온 처리 시간에 따라 점차proline 함량이 증가하는 현상을 보였다.
올리고펩타이드 전달체 관련 유전자(OsOPT10)가 도입된 형질전환 벼에서 고온 처리 후 이 유전자의 발현 양상을 확인하기 위하여, WT과 OsOPT10형질전환 벼 계통을 이용하여 정량적 실시간 PCR (Real time PCR) 분석하여 비교한 결과는 Figure 3과 같다. 대조구는 고온 처리 시간별 OsOPT10 유전자의 발현차이를 보이지 않았으나, 형질전환 벼 3계통, OsOPT10-1, -7, -16은 고온 6시간 처리후에 높게 발현량을 보였고, 이 후 고온 24시간 처리 조건에서는 점차 발현량이 감소하는 현상을 보였지만, 대조구에 비해 OsOPT10 형질전환 벼가 여전히 높은 발현 양상을 나타냈다.
일반 환경조건에서는 모품종(WT) 및 OsOPT10-1, 7, 16 계통의 전해질 누출(EL) 정도에 차이는 보이지 않았으나, 10일 고온 처리 후 WT의 EL 값은 형질전환 벼 3 계통에 비해 높게 나타났다. 대조구와 비교시, 형질전환 벼 3 계통, OsOPT10-1, 7, 16, 은 전해질 누출(EL)이 40% 정도 보다 낮게 나타났다(Fig. 2B). 대부분의 식물에서 건조 또는 염(NaCl) 스트레스에 대한 반응으로 sucrose와 같은 가용성 당의 축적이 보고되고 있다(Popp and Smirnoff, 1995).
본 실험에서 고온 처리에 의한 가용성 당 함량의 변화는 OsOPT10-16 형질전환 벼를 제외하고 OsOPT10-1 와 OsOPT10-7 계통이 WT 보다 당 함량이 높게 나타났다. 모 품종 동진에 비해 형질전환 벼 계통의 EL 값이 낮게 나타난 것과 가용성 당 함량이 비슷하거나 높게 나타난 것으로 보아 OsOPT10 형질전환 벼가 고온 스트레스에서 저항성 반응을 나타낸 것으로 판단하였다.
2C). 모품종 동진에 비해 형질전환 벼 계통의 EL 값이 낮게 나타난 것과 가용성 당 함량이 비슷하거나 높게 나타난 것으로 보아 OsOPT10 형질전환체가 고온 스트레스에서 저항성 반응을 나타내는 것으로 보인다.
고온 스트레스에 의한 세포막 피해 정도를 알아보기 위해 전해질 누출(electrolyte leakage), 삼투조절제 역할을 하는 수용성 당 및 proline 함량 분석을 하여 대조구와 비교분석 하였다. 본 실험에서 고온 처리에 의한 가용성 당 함량의 변화는 OsOPT10-16 형질전환 벼를 제외하고 OsOPT10-1 와 OsOPT10-7 계통이 WT 보다 당 함량이 높게 나타났다. 모 품종 동진에 비해 형질전환 벼 계통의 EL 값이 낮게 나타난 것과 가용성 당 함량이 비슷하거나 높게 나타난 것으로 보아 OsOPT10 형질전환 벼가 고온 스트레스에서 저항성 반응을 나타낸 것으로 판단하였다.
2012). 본 실험에서 고온 처리에 의한 가용성 당 함량의 변화는 OsOPT10-16 형질전환체를 제외하고 OsOPT10-1와 OsOPT10-7 계통이 WT 보다 당 함량이 높게 나타났다(Fig. 2C). 모품종 동진에 비해 형질전환 벼 계통의 EL 값이 낮게 나타난 것과 가용성 당 함량이 비슷하거나 높게 나타난 것으로 보아 OsOPT10 형질전환체가 고온 스트레스에서 저항성 반응을 나타내는 것으로 보인다.
일반 환경조건에서는 모품종(WT) 및 OsOPT10-1, 7, 16 계통의 전해질 누출(EL) 정도에 차이는 보이지 않았으나, 10일 고온 처리 후 WT의 EL 값은 형질전환 벼 3 계통에 비해 높게 나타났다.
시들음과 같은 조직의 손상과 잎 말림 현상 및 엽록소 감소 같은 위조 증상을 보였다. 처리 10일 후에, 형질전환체 OsOPT10-1, 7, 16 계통은 대조구(WT)와 OsOPT10-2, 4, 5 계통에 비해 피해 수준 및 저항성 정도가 차이가 있었으나 큰 차이는 보이지 않 았다. 그래서, 스트레스에 의한 세포막 피해 정도를 알아보기 위해 대표적인 표시자로 알려진 전해질 누출(electrolyte leakage) 분석을 하여 세포막 피해 정도를 비교하고자 하였 다(Allen et al.
2). 처리 후6일차까지 고온의 의한 피해증상이 큰 변화는 없었으나 7일차부터 식물체들이 고온에 의한 피해 증상이 나타났다. 시들음과 같은 조직의 손상과 잎 말림 현상 및 엽록소 감소 같은 위조 증상을 보였다.
질의응답
핵심어
질문
논문에서 추출한 답변
식물의 고온에 의한 간접적인 손상에는 어떤 것들이 있는가?
식물의 고온에 의한 직접적인 영향으 로는 단백질의 변성, 집적, 세포막 지질의 유동성 증가 등을 포함한다. 간접적인 손상으로는 엽록체와 미토콘드리아의 효소가 불활성화되고, 단백질 합성이 저해되며 합성된 단백질이 분해되고 세포막 손상을 일으킨다(Howarth. 2005).
고온 스트레스란?
지구온난화로 인해 온도 상승에 따른 고온 스트레스는 전세계 많은 지역에서 농업적으로 문제가 되고 있다. 고온 스트레스란 식물의 생장과 발달에 비가역적인 영향을 일으키는데 충분한 정도의 일정 시간과 기준 이상의 온도 상승에 노출되었을 때 식물이 받는 스트레스를 의미 한다(Wahid et al. 2007).
식물들이 세포 내에 수분을 유지시키기 위해 조절하는 것은?
온도가 높은 환경조건뿐만 아니라 다양한 비생물학적(abiotic) 스트레스 환경에서 생존 및 적응하기 위해서는 식물은 생리적 및 유전적인 변화를 통해서 반응한다. 불량한 환경에서 내성을 가진 식물들은 세포 내에 수분을 유지시키기 위해 수분스트레스에 의한 팽압과 세포내의 농도 (Lichtentaler 1995; bray 1997), 삼투 스트레스의 완화(Kishor et al. 1995) 등 세포질 내에 다양한 유기물을 축적하며 불량환경에 따른 유전자 발현을 조절하게 된다. Proline은 염분과 건조 스트레스와 같은 다양한 환경 스트레스에 피해를 입는 많은 식물에 있어서 osmoprotector로서 삼투압 조절에 중요한 역할을 하는 것으로 알려져 있다(Delauney and Verma 1993; Pollard and Wyn Jones, 1979).
참고문헌 (29)
Ahuja I, Vos RC, Bones AM, Hall RD (2010) Plant molecular stress responses face climate change. Trends Plant Sci 15:664-674
Cagnac O, Bourbouloux A, Chakrabarty D, Zhang MY, Delrot S (2004) AtOPT6 Transports Glutathione Derivatives and Is Induced by Primisulfuron. Plant Physiology 135:1378-1387
Foucaud C, Kunji ER, Hagting A, Richard J, Konings WN, Desmazeaud M, Poolman B (1995) Specificity of peptide transport systems in Lactococcus lactis: evidence for a third system which transports hydrophobic di-and tripeptides. Journal of bacteriology 177(16):4652-4657
Howarth CJ (2005) Genetic improvements of tolerance to high temperature. Abiotic stresses: plant resistance through breeding and molecular approaches. Howarth Press Inc., New York.
Igarashi Y, Yoshiba I, Yamaguchi-Shinozaki K, Wada K, Shinozaki K (1997) Characterization of the gene for delta1-pyrroline-5-carboxylate synthetase and correlation between the statement of the gene and salt tolerance in Oryza sativa L. Plant Mol Biol 33:857-865
Jung YJ, Lee IH, Han KH, Son CY, Cho YG, Lee MC, Kang KK (2010) Expression analysis and characterization of rice oligopeptide transport gene (OsOPT10) that contributes to salt stress tolerance. Journal of Plant Biotechnology 37(4):483-493
Kavi Kishor PB, Zonglie H, Miao GH, Hu CA, Verma DPS (1995) Overexpression of ${\Delta}1$ -pyrroline-5-carboxylate synthetase increases proline production and confers osmotolerance in transgenic plants. Plant Physiology 108(4):1387-1394
Kishor P, Hong Z, Miao G, Hu C, Verma D (1995) Overexpression of [delta]-pyrroline-5-carboxylate synthetase increases proline production and confers osmotolerance in transgenic plants. Plant Physiol. 108:1387-1394
Kropff MJ, Mathews RB, Vanlar HH, Tenberge HFM. (1995)'The rice model ORYZA1 and its testing', in: R.B. Matthews et al. (eds.), Modeling the Impact of Climate Change on Rice production in Asia. IRRI and CAB International. Wallingford, pp 27-50
Lichtentaler HK (1995) Vegetation stress: an introduction to the stress concept in plants. J PlantPhysiol 148:4-14
Lubkowitz MA, Hauser L, Breslav M, Naider F, Becker JM (1997) An oligopeptide transport gene from Candida albicans. Microbiology 143:387-396
Nagai T and Makino A. (2009) Differences between rice and wheat in temperature responses of photosynthesis and plant growth. Plant Cell Physiol 50:744-755
Popp M, Smirnoff N. (1995) Polyol accumulation and metabolism during water deficit, p. 199-215. In: Environment and Plant Metabolism : Flexibility and Acclimation (Smironoff, N. ed.). Bios Scientific oxford
Roosens NH, Willem R, Li Y, Verbruggen I, Biesemans M, Jacobs M (1999) Proline metabolism in the wild-type and in a salt tolerant mutant of Nictiana plumbaginifolia studied by 13C-nuclear magnetic resonance imaging. Plant Physiol 121:1281-1290
Song JY, Kim DS, Lee G-J, Lee IS, Kang KK, Yun SJ, Kang S-Y (2007) Characterization of Salt Tolerant Rice Mutant Lines Derived from Azetidine-2-Carboxylic Acid Resistant Cell Lines Induced by Gamma Ray Irradiation. J Plant Biotechnol 34:61-68
※ AI-Helper는 부적절한 답변을 할 수 있습니다.